Transcript

zfp36l1a-201

ID
ZDB-TSCRIPT-090929-19740
Name
zfp36l1a-201
Previous Names
  • zfp36l1a-001
  • zfp36l2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039444 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039444|OTTDARG00000028828|ZDB-GENE-030131-9860 zfp36l1a|OTTDARP00000031549 zfp36l2-001 LG_ CR388389.9 Danio rerio protein_coding KNOWN, 1899 bp
GAAATGCAGCGCGGCCACGGAGGAGCAAGACAGAGGGGGT
TTCTTTTAGGGCAACACAAGTTTACACAACCAGAACTAGC
TTGTTACAGTTTGAAGTTTCTGCTTTTTATTCCGCTGTTT
ATTTATCAACGATTGGAAGATGACCACAGCCGTGGTGTCG
CCTTTCTTCGACTTCAGCGAAATGATCAACAACAAGAACA
AAATGCTAAACTACAATAATAACATCCTCAGTTCTCCGCA
CCCTGTCTCCGTCCCTTGCACTGGGACTAGTCTGTCCATC
TCTAACCCCACTGGTTGCCTGCTGGACAGGAAGGCTGTGG
GGACACCCTCTACTGGTGGGGTTTACCAGCGCCGGCACTC
TGTAACTTCGGCTAACACCAAACTCAACCAAAACCAGTTT
TTGAACATTGCTAAGGCAGATCCATCCCTGCTTGGTTCAG
GGACAGGAACCACCGGCAGCAGCAACAAAGAGAACCGACT
CCGAGACCGCTCTTTCTCAGAGACAGGGGATCGCCTGCTA
CAGAAGTGTTCGGGCCCTGGAGGCCCCAACAGCCAGGTCA
ACTCGAGCCGCTACAAGACAGAGTTATGCAGGCCATTCGA
GGAGAATGGAGCTTGCAAGTACGGTGACAAGTGCCAGTTT
GCCCATGGCATTCATGAGTTGCGTAGCTTGAGTCGCCATC
CCAAGTACAAGACTGAGCTTTGCCGCACATTCCACACCAT
TGGCTTCTGCCCTTATGGCCCGCGCTGCCACTTCATCCAC
AATGCAGAAGAGCGACGAGGGCCTCCTCCAACCCCATCCC
CCCTTTCAGCATCCAACAAGATGGAGAGGCCAAGGCTGCA
ACACAGCTACAGCTTCGCGGGGTTCCCCAGCTCTGGAGGC
TTGAGGGACAGCCCCACTTCAGTCACCCCACCACCTATAT
TTTCCCCCGATGAGCTGCCCGAGTGGCCTAGCAGCAACCC
CTTCACGTATTCCAGCCAGGAGCTGGCCAACTTCTTCAGC
CCCAGCCTGGGTAATGCACCTTTGTCCTGCTCTGACCCTT
CCTCCCAGGCGCCACCTTCGCCAACATCAACCCCTTTCTA
CTTCAGGGCAATGTCAGAGTCTCCAAACCTCTACGAGTCT
CCATCCAGTCAGCCAGACTCACTTTCTGACCAAGAGGGCT
ACCAGAGCAGCTCAAGTGGAAGTCTAAGTGGATCTGAATC
TCCCGTCCTTGACACCACTCGCCGACTGCCCATCTTCAGC
AGGCTTTCCATCTCCGATGACTAAAGCGCACTGAGCCAGA
CCCCGTCCCCCTTTCCACTGCATGCAGCAGTCTTGAGAGG
ATGAGATGCTAGCACTCCCTCCACCTCTTGCCATTTCTCT
GGCCCCCTAGAAGCCGTACAGTTCCTTCCTTGTATTACTT
CCGCTCTGAAACCGATGCAGTGAATTAAGGGATCTTTCTC
TTTTTGAATACTCTTTTTAACCAGAACAAGCTAAAACTGT
CCCGGCCTCAAGACCCTTCTGTTTTCCGGGCCACATCATG
TCGAGCCCCTGCTATGTTCCTGGTGTGACTGTGCCAAACT
ACACAGAGTAGGAAGTGGATTAGCAAAATGCTAATCGTGA
GAGGTATGAGACCGTTGTGCCAGGTGCCACAGCTGTAGTC
AAGTGTAGCGGAGCTGGTGGCATGGTTAAGGGAGAACCCT
GCGCCCTTCCTTCCCCCTCACAAATCGCCACTCTTCTCAA
GGACACTCTTTCATAACTAACTAAAGTTCACAAGTGTCAT
GCTTAGACCTTTAACAACTGTCTTTGTAGACCGGCTTAAA
GCGAAAAACAGGAAAAGATGTGAAAAAAAGACAAGTGCCT
GGGGGTCGAGTGTTGGGGTGAATGGACCACTGTTTCTTTT
TATCTTTAATATATATATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations