Transcript

nkx2.9-201

ID
ZDB-TSCRIPT-090929-19737
Name
nkx2.9-201
Previous Names
  • nkx2.9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039441 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039441|OTTDARG00000028825|ZDB-GENE-030131-4340 nkx2.9|OTTDARP00000031546 nkx2.9-001 LG_ BX511145.13 Danio rerio protein_coding KNOWN, 1166 bp
GTCACTTCCATGTGCATCTTGAAACGCTCGCATCACTTCA
GCACCGCGTTAACGAGGACAGCTCTTCAAGAACCAGTCCT
GGAACTAATAGCAAACCTACGATACAAATGGCTATTTCAA
ACAAGTTCAGTTTCACTGTGAGAAGTATTTTGGATTTGCC
AGAAAATGACACGGAAAGCATCGTACAGCATTCTCCATTG
GACTCGTTTTCTGTCTCCCCTTACTCAACCTGGACTGAAA
ACGACAGAGGACATATATCGTCGGATGATAGCAATATTGA
AGCTTCGCCAGACTCCACAGAACCAGATGTGCTCTCCGTG
GACACAGAGCACGAAAAGAGGAAGAAGCGTCGCGTGTTAT
TCTCTAAAGCTCAGACTTATGAACTGGAGAGACGCTTTCG
TCAGCAGCGCTATCTGTCCGCTCCAGAAAGGGAGCAGCTG
GCGCACCTGCTCCGCCTCACGCCCACGCAGGTCAAGATCT
GGTTCCAAAACCACAGATACAAAATGAAGAGAGCGCGGAT
AGAGTGCGCTCAGGACCTTAACCAGCCTCCTGTGTTGCGC
AGAGTCGTGGTGCCCATTTTGGTTCGAGATGGCAAACCGT
ATCAGAACTGCACTATCGATACAGAAAAAGGAAACGGCAT
CGTTCCACCAACCGTGCCATCTTCACCGTTTACTGTTCAA
GGTTTCCATTCTTTACAGCAACAGACGCCCTTTGCGCTTT
TCCCCACATACCAGCACTTTACTAACACAGCGGCCTCCCG
GCACCACTTTTGTGTTTGGTGAGACTTATGACAACACGAA
CTATTTCGGGACTTAGCGCAAGCATCCATCTCAATTAAAG
TTGTTTTAATTGTATAAAGTGATAGGTCTATTCAAGTAGA
AATATTCAGCGTTGATAAGATTTTTAAAAAATGCTGTTTG
CACATATTAGATGGTCGATTTAGTTTCGTTTGCCCAGTTG
CGTTTTGCAAATTGTTGTGTAATAAGTGCTGTCGTGTGTG
ATTTCCTAGTTTCATAGTTTATTGTTAAAATTTTGCATTT
TTTTTCTGAACCAAAAGTTTATATATCAGTGAGAAAACCA
TGTTTTATGTAGTTTCATTTTTTTTATAAAATGAAGTGTT
AAATGTTTTCATTCTTTATTCTATGTATTAAAAAAACTGA
AAAAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations