Transcript

nkx6.3-202

ID
ZDB-TSCRIPT-090929-19735
Name
nkx6.3-202
Previous Names
  • nkx6.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039439 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039439|OTTDARG00000028823|ZDB-GENE-070810-7 nkx6.3|OTTDARP00000031544 nkx6.3-001 LG_ BX571947.8 Danio rerio protein_coding KNOWN, 371 bp
AATGTGGGGAAAAAAAAGCACACACGACCTACATTCAGTG
GGCATCAGATCTTTGCTCTGGAGAAAACCTTTGAACAGAC
CAAGTATTTGGCAGGACCAGAGAGAGCCAGACTGGCATAC
TCGCTAGGGATGACTGAGTCACAAGTTAAAGTGTGGTTCC
AGAATCGGCGTACTAAATGGCGGAAAAAGAGCGCAACGGA
GCCCAGTTCCACACAGACCTCGCGTGGGGAGAGTGCAGGA
GACGGGTCGGAAAATGAGGTGGAGGACGAGGAGTACAACA
AACCTCTGGACCCCGACACAGACGATGAGAAGATACGACA
GCTGCTGCGCAAACACCGCAGAGCTTTCTCAGTACTGCGC
CTGGGGCCACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations