ZFIN ID: ZDB-TSCRIPT-090929-197
Transcript Name: hdhd3-201
Previous Names: hdhd3-001, si:ch211-10e8.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002358 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002358|OTTDARG00000002187|ZDB-GENE-040724-118 hdhd3|OTTDARP00000002085 CH211-10E8.6-001 LG_ AL732598.10 Danio rerio protein_coding KNOWN, 1395 bp
TTTTATTGGTTTAACAATCCCTAACTCCACAAAAAAAACA
TATTGAGATTTTAAAGTAGACCAATATTGAATATCATAAT
ATTGTGAGCCACCAAGCGCCTCCTAGAGACAAGCGACTGT
TAATCTTCTAGTTAGCAGTCTGTTTACCTTCGGTCTCCCC
TGTGTTTGTTTTTTAACGCTCCGCGTGTCCTCTGCAGCAG
GTCATGTATGCCTCACCTTCTATAAAAGTGTGATATTTTA
GTGTGTTCGGTAATGCGGGTGCCGGTGCGGTGGGTGCTGT
GGGATGTGAAGGACACCTTGCTGAAGGTGCGGCGCTCGGT
TGGAGAGCAGTACTGCAGAGAAGCTCAGCAAGCAGGACTC
CAGCTGTCCCCTGCTCAGGTGGAAACTGCCTTCAGACTGG
CCTACAAGCAAAAATCACAGCTATTGCCAAACTATGGCCG
AGCTCAGGGCATGGACAGCCAGGTCTGGTGGACTGGTCTA
GTGAGGGACACTTTTGGCCAGTGTGGGGTCCATGATCCTG
CTTTGCTGGACAAACTAGCCAACAATCTCTATCACAACTT
TTGTGGACCAGAAAACTGGGAGGTGTTTTCAGATTCTAAC
AGCACCCTGAAGTCCTGCACCGCTTTGGGACTCAAGCAAG
GTGTTGTTTCCAACTTCGACAGGCGTTTGGAAGGGATCCT
GAGGGGATGCGGTCTTCTCACTCACTTCTCATTTATTGTG
ACCTCAGAAGACGCCAGGGTTGCTAAACCAGACCCTGCCA
TATTTAGCCAAGCACTGGAGCGGTGTGGAGTTCCTGCCTC
CAGTGTAGTGCATGTTGGGGACCATTATGTGAAAGACTAT
CTGACCTCTCGCTCTTTGGGAATTCGAGGTTACCTTCTCA
ACAGAAAAGACGGTCAAAAGACGCACCTTGATATTCCTCC
AGAGCATATACTGCAAAGCTTAGATGAACTACCGGCTCGA
CTGCAGCATAACACAGACTGAGTGTGTGTAATATATAGTT
TAGATTTAATTTAATTCTGTAATGTACTGTCATTTTATTT
AATTGTTATTCTGCTCTTTAATTATTTGAATAACTGAGTT
GTCTAATTGTTATCCACTGCTTTGTTTAAAAGTAAATTTT
GATATGATGCAGCTCTCAAATTCATTAGGTATGACTGACT
GACAGCTATAGTGCCACATATAAACTCACTAGACACTTTA
TTAGGTACACCTTGTTCATACTTGGTTGGACCCCATTCAG
AACTGACTTAATTCTTAATATTGAATAGAAAGTACTGGAA
GACATTAGCACATACTGACATGTTGGCATCACTCAGTTGC
TGAAGATTTCTTAGCTTCACATCCATGGTGTGAATTTCCC
ATCCACCACATATTAAAGCTGCTTTGTTGAACTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hdhd3-201 Contained in:
[BAC] CH211-10E8 (1)

Genome Resources: Vega_Trans:OTTDART00000002358 (1),  Ensembl_Trans:ENSDART00000103776 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC116519 (1) 1478 nt
GenBank:BC095713 (1) 964 nt
GenBank:CN023239 (1) 865 nt
GenBank:CN833765 (1) 856 nt
GenBank:CN167696 (1) 847 nt
GenBank:DT879936 (1) 783 nt
CITATIONS (2)