Transcript

zgc:85722-201

ID
ZDB-TSCRIPT-090929-19674
Name
zgc:85722-201
Previous Names
  • zgc:85722-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039376 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039376|OTTDARG00000028788|ZDB-GENE-040516-7 zgc:85722|OTTDARP00000031501 CH211-270G19.4-001 LG_none BX276081.12,CU929425.3,CU929089.13 Danio rerio protein_coding KNOWN, 3814 bp
GCATCATCATCATCATCAGCCTCAGTGCGCGCTGGTGATG
GTGATGTTGATGATGCTTCGAATGTTATTCATTTCGTTCT
TTGTCGTTCGTTTCCCGCCATTGATTATTAACTGACTGAC
TGGTGTGGACCAATAAAACCCGCTGAAATCAGACGCTGGA
AATACTGGCGATTCACGTGAACAGACGCTGAAAGAGAAAC
AGCATGATGGGTTTACATGAGTTCATATGGATGACAGGTG
TACTAATGGCGCAGGACCGTCTTTAACCTGTTTGCGAGGG
CTTATTTGATCGTGACAGGACGTGAAGATGGCGACGGGCA
CGGGCTGGCAGCCGCCGTACAGCGCTGCTCCGGGCATCAG
CCCTCCCGCCGCCGCCGCCGCCGCTTCTTCAGCTTCTGGA
TCCGGCAGCAGTCCATCCTCCACGTCCAGCCATTTACTCT
ACGAATCTGCCCTGACCATGGAGTACACTCAAGATCTGCA
CCTGAAGATGAGCAAAAAAATAGCACAACTCACTAAGGTT
ATTTATGCCCTCAACACCAAAAACGACGAGCACGAAGACG
CCATCCAGTCTCTAAAGGAGGCCCACGACGAGGAGGTGCA
GCACATCCTCACAGAGACTCGAGAGAAGATCCTGCACTAC
AAAAGCAAGATCGGGGATGAGGCCGACCTGAAGCGGCGCT
TGCAGTCTCTGGAGGAGTCAGTGGAGCTCCACGAACACAT
GAAACGCCAAGCTCTGGCTGAGTTCGAGATGTACCGCCAG
CGCATGGAGGACACACAGCTGTGCACCGAAGCCCAGCACA
CCCAACGCGTGGTCTCCATGTCGCGGGAAGTCGAAGAAAT
GCGACACGAATTTGAAGAGAAGCTGCGCACTTTCAGCCAG
GTCCAAGCTCAGTTTGAGCAGGAGAAACGGCACGCGTTGG
ATGACCTCAAATCAGCCCATCGGCAAGAAGTTGAAGATCT
GTTGGAGAGCCAGCAGAACCAGAGTGCATCCTCCAGCCTG
GAGCAGGAGAAACTGGCCGAACTTCACCGCACAGAGCTGG
AGTCTCTGATGGAGCGCGTGGAGGAGCTAATGCAGGATAA
AGTGCGGCTCGCCGAGGAATACGAAGCCAAGCTGAGTAAA
GCGCAAGGGTTTTACGAACGTGAGCTGGAGGCCATGAGGC
GCACACAGCAGCTTACCACCGAAAACCTGCTGGCCTGGAA
GAGGACTGAGGTGGAGCTGAGGAAGGACTTTCAGATGCAG
GAGGCGGCACTGCAGAGGACTCTGTGTAAACTGCGATCCG
AACTGCACAGAGCTCAGGAGGAGGCCAGAGAGAGCAGAGA
CAAGACCAACCGGCTGCAGGCCTCGCTCAATAATGCTGAA
GTCACAATTAAGGAGCTACACAAGCAGCTGGAAGAGGCCA
TACAGGATGGAGAGATTTGGGTGATGCAGCTGAAAGATAC
TGAATATGAGCTGGAGGGAAGCAGAGATCGAGTTCAGCAG
CAGGCCAATGAAATCCTTCACAAAGCCAGTCAGATTGGAT
CGCTTCAAGCCACCCAAATGAGCCACGAGGCCACTATTAG
GGATCTGGGCTCTGAGCAGAACCGGCTGAAGGAGAAGATC
CTGCAGCTGGAGGAGGAGAGAGAGAGGCTGCAGAAACAGA
TGCAGACGCTGGAAGAGCAGCAGCACCAGAAGATCCTCAA
CCTAGAGAAGTCGCTCCGTGAGGAAAAGCAGAGCTATGAG
ATGGAGCTGGCGCGAATCAGGGCCAAATACGAGGAGGAAA
TGTCCTGTCTGAAAGAAAGCCAGGCAGAATCCATAGAAGA
ACTCAAGGAGAAACACCGAGTCCAGCAAGAAAGTGTTCGC
AATGCTGCTGAGAGAGAGAAAAACCAACTGCTCAGTGAGA
TGAGACAACAGTTTGATATCCGCCGTCTGTCACTGGAAGA
GCAGAGAAACCATTTACAGCAGCAGCTGGAGACCATACGA
GAGGAGCTCACCACCAAACTCAACATGGCCAACCAAGAGG
TGTCTCATTTGAAGGATCTTGTGAAGGAGAGTGAAGAAAA
TCTGGATGCCGCTGAGAGCCACATCTCCTGTCTTAAAGAC
AGCCAAGAGAAGCTTCTCATCGAGCTGGACGTCACCAGGG
CCAGAGTGAGGGAGACAAGCAATCTGCTCACAGATCTACA
AGAGGAGATCGAGACCCAGAAACAGCAGCATGAAGCCAGA
GCCATCGCTATCAAAACAGAGGAGAAGCAAAAAATGGACA
AAATCACAGAGGAGCTTGATCTCAAGTGGACTGACGCTCT
GAGGGCTGAGCTAAAGGGTCTTCGGGAGGAGCTTACAGCT
GAACATCAGGCGGAGAAACAGGTGGCGCTGACACAACTTT
CCCAGCAGAGAGATCTGGAGATGATGGCGGCTAGAGAGAG
CTGGCAGAGGAAGGTGGAGGATCTTCTGGAGCAGATCTCG
CTGCTGAAACAGAGCCTGGAGCTGCAGATGTCGCAGTCGA
AGAGCGCGCTGCAGCAGCTACAGGCGCAGTTCAGTCAGGA
GCGTGAACACCTGGCACAGCAGCTGCAGGAGGTGGCACTG
GAGCAGCAGCACAGAGAGCACCGTCTGCAGGAGGCACACT
GCTGTGCCATGCAGGACATGGAGGACGCACAGCAGATGGA
ACTCTCGGAGCTGGAGGACCGTCTGAAACAGGAACAGAGG
GAAGAGTTGCACGCTTTGAGAGAAGCCCACAGACAGACTC
TGGATATACTCCAACAGCAATCGGACCAGGAGCTGCAGAC
GCTGCGCTTTGAGCTGGAAGATGAAGGCAAAGCCATGCTG
GCTTCTCTGCGGTCGGAGCTCAATCATCTCCACGCCACTG
CCATTGAACACCTCAGACAAGTCCACTTGAAGGAGAACAA
CGCTGCCAAACGAGAGCTGGACGACACCATTGATCGCTGC
AAAGAACATGAGCAGGACCTTTTGGGTCGTATCTCTGACC
TGAGGCAGGAGGTGAGCTGCAGGAAGAACCGCATCGCTGA
TCTGGACCATGAAATCCACTCGCTCAATGAGACCATCAGC
ACACTAACCAAGGAGCTGGAGCTCAAAGGGAAAGAAGTTC
TGCGGGTGCGCAGTGAAGCCAACCTGCAGATCAGGGCTCG
TGAACAGGATCTTTCCAAGCGCCTCGAGAGGGAGATTGAC
GAGCTGAACGCTTCACATAACAGAGAGACCCAGATCATGC
TGTCAGATTTTAACAAAGCTCAGGAGCTGCTAAAAGACAA
GATCTCAGCTCTGCAGATTCTGTTGGAAGGTACGGAGGAG
AAGTTCAGGAATAGAGAAAGCCGTCCGGAGGACCTCCAGG
TCATTGCAGATCTCAGAGAGATGGTGTCAGAGAGAGAAAC
CTTGGTCAAGAAGCTTGTGGATGACAAGAAGTTTTATCAA
CTGGAGCTGGTGAATCGAGAACCTGGCTTCAACAAGGTGT
TCAACACCAATCCCAATGTCGGGGTCATAAACCCCCTTAT
AAAGCCCTCGTAAGACTGGGGATCCAACTGTAGCACCAAA
AGAACAGCAACCACAAGAGCTATTTTCACAGTACTTCTCC
TTTTAAATTTTTCAAGACACTCAACTCAAGAGCATGTGAA
ACTGCAGTTTTCAATAGTCCATTCGTCTGTTCTTGATATC
TCACTGTGAGTTTGTTATTTTCCCTTTTTGATATGGGCAT
TTACTTGATTTAAAATGAGATGCACACTCATTTCATATAC
TATTCATAAATGTATTTTCTGGATGGACTAAAACTGTTGG
AATACCAATGTCTTGCCAGTTTTGAAATAAATTGCACAGA
CACTTACATATATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations