ZFIN ID: ZDB-TSCRIPT-090929-19581
Transcript Name: fbxo45-201
Previous Names: fbxo45-001, zgc:65875-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039280 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039280|OTTDARG00000028733|ZDB-GENE-040426-1450 fbxo45|OTTDARP00000031426 fbxo45-001 LG_ CT955984.6 Danio rerio protein_coding KNOWN, 1789 bp
ATAGTCACATAGCTTAGATTTGATCCGTTTGGCCGCAACT
GCAATAACACTGGGAGATGTGTCAAGCGAACGTGCTTCAC
GGGGCCGCGGCGGGGTTCTGACCCGCTCTTCAACCCGGCT
GTGCGGCGATATCAACGCTTGCTCTCGGCGGAGGAGTCTG
TCATGTCTGGCGCAGTGGCCACTGGAGGGGCGCAGTCCGC
GGGTCTGGGCGCTGCCGCCGCGGGCTGCTGCTCCTCCGCG
TCGGGCGCCGGTTCTGCCGCATTATTAAGCGCAGGATCGG
GCATCGCAGGCCGGTTACCGAGCCGTGTTCTCGAGCATAT
ATTCTCATATCTAGAGCTGATGGATCTGCTAAACTGCTCG
CTCGTTTGCTGGCACTGGAACAACTGTCTGTCGGATGAAA
ACAGCGAGGTGTGGCGGAGTCTGTGCGCCCGTTCACTGAG
TGATGAAGCGATGCGCTCTGATATCCTCTGCAACCTGGCT
TCATATAAAGGAAAACTGAAGTCTTTCCAGCACGCTCTGA
GCTCCCATGACTGCTCCAGAAATGTATATATCAAGAAAAA
CGGGTTCACCCTGCACCGCAACCCCATCGCCCAAAGCACC
GACGGCGCCCGCGGGAAGATTGGCTTCTCTGAAGGGCGTC
ACGCCTGGGAGATCTGGTGGGAGGGTCCTTTGGGCACGGT
GGCGGTTATTGGCATCGCCACCAAGAGGGCTCCCATGCAG
TGCCAGGGCTATGTGGCACTTCTAGGCAGCGATGACCAGA
GCTGGGGGTGGAATCTAGTAGATAATAACCTGCTTCACAA
TGGAGAGGTCAACGGCAACTTTCCCCAGTGCAACAATGCA
CCAAAATACCAGATAGGCGAGAGAATACGAGTAATCCTAG
ACATGGATGATAAGACACTAGCCTTCGAGCGAGGCTTTGA
GTTCCTTGGAGTGGCTTTCCGAGGACTGCCCAAAACATGC
CTCTTTCCAGCGGTTTCGGCCGTATATGGGAACACTGAAG
TGACTATGGTGTATTTGGGAAGACCTCTCGATGGATAAAC
ATACATATTGGATATCAGTGCCATTCATAACGCCGGAGAG
CATCATGGGATCCGCTGCTTGGCATAGATAAGACTCATGG
CTTTTCACATTTGGACTAAAAAAAAAAAAGTAAGGGAGTT
TGGCTGGTGGGTGGCGGGATTGATGATGGTGAGGATGTCC
AACACACATCTGCGGATTCAGTTTTTAATGCATTTTGAAA
ACCTGGGACACTTTTTTTTTTAAATACCTGGTTTTAATCT
AATTTATGAGATCGCACAGGGAGCAGCTGTTCTATTTTAT
GAAATAGGTTAAAAAAATTAAGCCAAACTAGAAGAGACAC
GTGGCAAAGTTTTATAATTCATTACAAACATTTTACACAC
GCAAGGAATGAGAAGCTACTGTACGAATGAGAGGATGATT
CATGCTTTCACACACACACACACACACACACACACACAAA
GCATTTACGTGTACAGTAGGTAAATTTAAGACGTAAACAT
GCCAAATAATGTTTGGATATTTACCGTACTGTTTTTTTTT
TCAGAGCAGTTATCTGCATGCAGTATACCAGTCTCTTCCT
GTTTTTAATATTATTATTTTTAAGGACAGGCAAAGGTAGT
ATTTGGCTATTCTGTTTGTTACTGTACATCTTAACTGTGA
TGTAGAAGTGTATAGTATTTATTTATTGAGGTCTATCTTT
GCTATAACCGATGGTTATGGAGACTGCAAATAAACTCTAA
ATTGTGCCAGACTGTGAACGTATCACAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fbxo45-201 Contained in:
[BAC] CH73-165P10 (1)

Genome Resources: Vega_Trans:OTTDART00000039280 (1),  Ensembl_Trans:ENSDART00000125412 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC066397 (1) 1736 nt
GenBank:BC056756 (1) 1146 nt
GenBank:EH552481 (1) 978 nt
GenBank:EH573606 (1) 934 nt
GenBank:CD756033 (1) 898 nt
CITATIONS (2)