Transcript

fbxo45-201

ID
ZDB-TSCRIPT-090929-19581
Name
fbxo45-201
Previous Names
  • fbxo45-001
  • zgc:65875-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039280 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039280|OTTDARG00000028733|ZDB-GENE-040426-1450 fbxo45|OTTDARP00000031426 fbxo45-001 LG_ CT955984.6 Danio rerio protein_coding KNOWN, 1789 bp
ATAGTCACATAGCTTAGATTTGATCCGTTTGGCCGCAACT
GCAATAACACTGGGAGATGTGTCAAGCGAACGTGCTTCAC
GGGGCCGCGGCGGGGTTCTGACCCGCTCTTCAACCCGGCT
GTGCGGCGATATCAACGCTTGCTCTCGGCGGAGGAGTCTG
TCATGTCTGGCGCAGTGGCCACTGGAGGGGCGCAGTCCGC
GGGTCTGGGCGCTGCCGCCGCGGGCTGCTGCTCCTCCGCG
TCGGGCGCCGGTTCTGCCGCATTATTAAGCGCAGGATCGG
GCATCGCAGGCCGGTTACCGAGCCGTGTTCTCGAGCATAT
ATTCTCATATCTAGAGCTGATGGATCTGCTAAACTGCTCG
CTCGTTTGCTGGCACTGGAACAACTGTCTGTCGGATGAAA
ACAGCGAGGTGTGGCGGAGTCTGTGCGCCCGTTCACTGAG
TGATGAAGCGATGCGCTCTGATATCCTCTGCAACCTGGCT
TCATATAAAGGAAAACTGAAGTCTTTCCAGCACGCTCTGA
GCTCCCATGACTGCTCCAGAAATGTATATATCAAGAAAAA
CGGGTTCACCCTGCACCGCAACCCCATCGCCCAAAGCACC
GACGGCGCCCGCGGGAAGATTGGCTTCTCTGAAGGGCGTC
ACGCCTGGGAGATCTGGTGGGAGGGTCCTTTGGGCACGGT
GGCGGTTATTGGCATCGCCACCAAGAGGGCTCCCATGCAG
TGCCAGGGCTATGTGGCACTTCTAGGCAGCGATGACCAGA
GCTGGGGGTGGAATCTAGTAGATAATAACCTGCTTCACAA
TGGAGAGGTCAACGGCAACTTTCCCCAGTGCAACAATGCA
CCAAAATACCAGATAGGCGAGAGAATACGAGTAATCCTAG
ACATGGATGATAAGACACTAGCCTTCGAGCGAGGCTTTGA
GTTCCTTGGAGTGGCTTTCCGAGGACTGCCCAAAACATGC
CTCTTTCCAGCGGTTTCGGCCGTATATGGGAACACTGAAG
TGACTATGGTGTATTTGGGAAGACCTCTCGATGGATAAAC
ATACATATTGGATATCAGTGCCATTCATAACGCCGGAGAG
CATCATGGGATCCGCTGCTTGGCATAGATAAGACTCATGG
CTTTTCACATTTGGACTAAAAAAAAAAAAGTAAGGGAGTT
TGGCTGGTGGGTGGCGGGATTGATGATGGTGAGGATGTCC
AACACACATCTGCGGATTCAGTTTTTAATGCATTTTGAAA
ACCTGGGACACTTTTTTTTTTAAATACCTGGTTTTAATCT
AATTTATGAGATCGCACAGGGAGCAGCTGTTCTATTTTAT
GAAATAGGTTAAAAAAATTAAGCCAAACTAGAAGAGACAC
GTGGCAAAGTTTTATAATTCATTACAAACATTTTACACAC
GCAAGGAATGAGAAGCTACTGTACGAATGAGAGGATGATT
CATGCTTTCACACACACACACACACACACACACACACAAA
GCATTTACGTGTACAGTAGGTAAATTTAAGACGTAAACAT
GCCAAATAATGTTTGGATATTTACCGTACTGTTTTTTTTT
TCAGAGCAGTTATCTGCATGCAGTATACCAGTCTCTTCCT
GTTTTTAATATTATTATTTTTAAGGACAGGCAAAGGTAGT
ATTTGGCTATTCTGTTTGTTACTGTACATCTTAACTGTGA
TGTAGAAGTGTATAGTATTTATTTATTGAGGTCTATCTTT
GCTATAACCGATGGTTATGGAGACTGCAAATAAACTCTAA
ATTGTGCCAGACTGTGAACGTATCACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations