Transcript

sgk3-201

ID
ZDB-TSCRIPT-090929-19542
Name
sgk3-201
Previous Names
  • sgk3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039239 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039239|OTTDARG00000028709|ZDB-GENE-070424-62 sgk3|OTTDARP00000031399 DKEY-162H1.5-001 LG_ BX470095.12 Danio rerio protein_coding KNOWN, 2936 bp
GCGTGACTGATTGTTTCGGAACTTCGAAACAAACATCAGC
GTGTCTGTCTTTCTCTCACGGGTGGCTCATCGGGAACATA
ATGAATGTCGGGGAGGACAAACTCTTTCAGTTCAGCCGGG
TCAACATTTAGCGCCCAGAGACGCCGAGCTGGATTTTTGA
ATCGCTGGACTTCCTTTGCCTCCCGACACGTCACTGGAGT
CAGTTGGATGGAAAGAGTGAAAAAATAAGGAGCCAGAATG
GAAAGTTCCCATCAGAATCAGGTGTGCCAAAGAAGCAGGA
AAGCTTTCTGAGGACCTGTTACGTTTATGAACGGTCACTT
TTGAGATTCTGAGAGGATGGAAGAGCAACCTAGCTGTCCC
AATGTTAGCATTCCATGCTATAATGAGCAGAGGGACAAGA
AGAAACGCTATACTGTTTACAAAGTTATGGTCAGTGTTGG
AAGGCATGAGTGGTTTGTGTTCCGGAGATATGCAGAATTT
GACAAATTGTACAACACGTTGAAAAAACAATTTCCTGCGC
TGAATTTGAAGATTCCTGCTAAGAGAATATTTGGCGACAA
TTTTGACCCAGAGTTTATAAAACAGAGACGAGCGGGGTTA
CATGAGTTCATTCAGAGGATCGTGTCCCATTCACAGCTCT
GCAGCCATCCCGATGTCAAAGTCTTTCTGCAGATGGACAA
AGCCAAAAACTTCTCTGATGGCTCAGAGGATGAAGACGAC
AAGAGTAACTCTACCTCTAGAAACATTAACCTGGGGCCAT
CTGCAAATCCACATGCAAAGCCCACTGACTTTGACTTTCT
TAAAGTCATAGGAAAGGGAAGCTTTGGGAAGGTTCTCCTT
GCAAAGAGGAAACGGGATGGGAAGTGTTATGCCATCAAAG
TCTTGCAAAAAAAGGTCATTCTAAACAGGAGAGAGCAAAA
GCACATCATGGCTGAGCGCAATGTGTTGCTGAAGAATGTT
AAACACCCCTTCCTGGTTGGCCTGCACTATTCCTTTCAGA
CAACGGACAAGCTATACTTTGTTCTGGATTTTGTCAATGG
TGGAGAACTTTTCTTTCATCTCCAAAAAGAGCGGACCTTT
CCTGAACCCAGAGCAAAGTTTTATATTGCGGAGATGGCGA
GCGCTCTGGGTTACTTGCACTCTCTTAACATTGTTTACAG
GGATTTAAAACCAGAAAATATCCTGCTGGACTCTCAAGGC
CATATAGTCTTGACTGACTTTGGACTGTGTAAGGAGGGCA
TCTCTCAAGCAGACACAACAACCACATTTTGTGGAACACC
TGAGTATCTAGCTCCAGAAGTACTCAGGAAACAACCCTAT
GATAACACTGTGGACTGGTGGTGTCTGGGTTCCGTGCTGT
ATGAAATGCTTTATGGACTGCCTCCGTTCTACAGCAGGGA
CACGCATGAGATGTATGACAACATTCTTCACAAGGAGCTT
GTCATGCGGCCCGGGGCGTCCACAGCTGCGTGGTCCATCC
TTCAGACCCTGCTGGAGAAAGACCACACCAGGAGGCTTGG
CTACAGAGATGACTTTAATGAAGTCAAAGAACATGAATTT
TTCTCATCTATTAACTGGTATGACCTTGAACAGAAAAAGC
TTTCTCCTCCATTTAACCCTAGTGTGGAATCCCAGTATGA
CATCTCAAACTTTGATCCAGAGTTTACAGAGGAAACCGTG
CCAAACTCTGTGTGCTTCTCATCAGGGCCGTCGATCGTCA
ATGCGAGTGTCATGGAAGCGGACGATGCCTTTCTGGGATT
TTCTTACGCTCCGCCATCAGAAGATTCTTTCTTGTAAGGT
TGGCGCTGCTAATGGCGATTTAAAGAGAGCTGCATAAAAA
TAAATATCTGTGATCGCACTCTCTGACGAAAGGGAAGAAT
CTGCCTAGCATCATGTTTCCATCAGATGGTGTGGACCCTT
GTGTTTCTTGACAGAAGCAGTGCATAAAGCTTTTGGGATG
CAGGGTGTTTCAAACTTTATTTTTACATGTAAATAACATA
TCTTGTGTCACATTGAACGCCTTAAACTGAGAGTTTAGCT
CAGGAGCTAAAGTGCTGATGTATTTTTCTTTGCTATGAAT
TATTTTCAAGGGCTGATGAGAAGAAAAAAAACAAACATCC
ACTTTGACAACATTCCTTTTTTGTGCCCCAACTTGTACAC
TTGATTGCTTATAATACTGTGCAGTATGTGACCAATTATG
TCATTGTAGTTTAGTCTTATTAGAAATTTGCTATGGAAAA
ATGTTTATATATTGTCAGCACAAGCAAATACTTTTGTTGC
TTGACACTTTAAATTAATATATATATATTCTCTCTATACT
GTTTAACCTGTTTGAGTTAGAAAACAGGCTAATCAAAGTG
CATTTTGATATAACCCTTTAAATTATGGGTCATCAACAGC
TGTATTACACTATAAACCGAACATTAGTTGCTGTATTTAC
ATGTTAGATTTTTATGAGTAACTTAAAGGGATAGTAGATT
TGCTGTTAATTTACTTGCACTCTGGCTTTCAAGATGAAGA
TCACTTATTTTTTTAGTAACATTAAATAAGATTTTTGTTG
AAACTTTGGTGATTCTTAAAACACACGTTAATGGCTAAGA
ATAAAAAATAAATAAACAAAATAATAGCTGTGGGTGCCAG
TACTATCCACTTACATTTTATGAGTCACTAAGTATCAGTT
TCCACATAAAATATTCTTTAATGTTCAACTAAAGTAAAAG
GTCACCTTTATCTTGGATGGTAATATGTAAATTAACGGCA
GATTTTTAATTTTGGATGAACTCGGACTGTCCATTTGAAT
ACTGACAATGACCCTGTAATAAACCACTATCATGTTATGC
CACCCTCAGATTATGAGAAGAGACACCATAGTGCCTACTG
AATTAATGATATGACCTTTAAATGATGTACTGTACAAGTA
AACACACCTTCTTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations