Transcript

fam162a-201

ID
ZDB-TSCRIPT-090929-19512
Name
fam162a-201
Previous Names
  • fam162a-001
  • zgc:162943-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039209 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039209|OTTDARG00000028693|ZDB-GENE-030131-8307 fam162a|OTTDARP00000031372 CH211-161H7.3-001 LG_ CR450812.5 Danio rerio protein_coding KNOWN, 803 bp
AAACTGACTTTCAGGTACTTAGAGGAAGTAAGCCTGGCAT
TGTCATTTTGCCACGATTTAATGGCATAAAACTGTCTTTT
CTCTCTCATCATATTTTCCTTCAGAAGCGATGATGTTCAG
CATGATCCGCGGGCCTCGCGCCGCTTTTGGCACTTTAATA
GGGCAGTGGAGGAGAGGTATGATGACCACAGGGAACAGAA
GACTGTGTATCAAGCCTCAGGAAGGGCCATCTGCATCCCC
TCAGACACAACGGCCTGGTTTTAAACTACCAGGCTACCGG
CCGTCAGATTGGGATAAGAAGATGTTGATGTGGTCAGGAC
GATTCAAAACCGTAGAGCAGATTCCAGAGTTTGTGTCATT
CGAGATGATTGATGCTGCCAGGAACAGAGTGCGTGTGAAG
GCCTGCTATATCATGATGGGACTGACCATCTTTGCGTGCT
TAGTCATGATCGTCTCTGGCAAAAAGGCTGTTAGTCGGAA
TGAAAGTCTGATCGCTATTAACATGGAGAAGAAGGCCAAA
TGGAGAGAGGACGCCATGAGAGAGAAAGAGGAAAATGCCC
TTGACGCTAAAGCCCAGTGAGATCCAACTGAGCTCCCAAA
ACCCATCATTCACAAAGCAACCATTTCTTCTAAATAATGT
CAAACGCCACACCGCAGGAACTCTGGTGGAGGTGGTACAG
ATATTCCTCCACACAGTTAACAGATTTTATAAAGTAGTGT
ATTAAATTAAATTGCGAGATTTCCTTTGTGTGTTTATTGT
AAATATATATTCGGAATAAATAGGGTTTCAGTTGAACATA
AAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations