ZFIN ID: ZDB-TSCRIPT-090929-1944
Transcript Name: kctd3-201
Previous Names: kctd3-002, ottdart00000011313

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011313 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011313|OTTDARG00000009856|ZDB-GENE-060503-169 kctd3|OTTDARP00000009740 DKEY-46N18.2-001 LG_ AL845481.5 Danio rerio protein_coding NOVEL, 3547 bp
GCTGACGCTCCGATGAGTCCACTGTGTTCCAGCATCGCTC
TATGGCGCCCACAACACAGAACAGAGCGATCCCGAGTCCG
TCAGGCTACAGAAAGGGGCCTTTGACAGTCGAAGGCCGTT
TTTTGAGTAGTTTATTAAAGCTCTGAATATGGAGAACACT
GTGTACGAGCAGCCCCATCTTACTCGTTTCTCTCGGGACG
CGTAGTTTATGGGTTCGCAGGGTCGCGAGGAAGAATAGGG
AGAATCCCGAGGACTCCAGCTGGATCCATGAACAATCTAG
ATCTTCAAACCGCTTGTTTTCCTCCTCGCTGACCGTAAGG
ATTTAGACAGGATGGCTGGGACTGGGAACAGCTCAACATC
TGGAATGGGTGACATCATCCAGCTGAATGTTGGGGGAACG
AGATTTAGCACATCAAGGCAGACTCTGACATGGATTCCTG
ACTCTTTCTTCTCAAGTTTACTTAGTGGGAGAATATCAAC
GCTACGGGATGAAACTGGAGCTATCTTCATTGACAGAGAC
CCAACAGCGTTTGCACCCATTTTAAACTTCCTTCGAACTA
AAGAATTGGACCTGAGAGGGGTTAACATAAGCATCCTGCG
ACATGAAGCTGAGTTCTATGGTATTACACCTTTAGTGCGA
CGCTTACTGCTTTGTGAAGAACTGGAGAGGTCCTCTTGTG
GAAGTGTGTTGTTTCATGGCTACCTCCCTCCACCAGCTCT
GCCGGCGCGAAGCAGTGCTGTTGGACAGGCTTCAGCTGTT
ATCGGTCCAGAGGAGCGCTCGGGTCCTGCTGGTGCAGAGG
GGGGTTACCCTCGTTCCTGTCCTCAGTCTTCTCTGCCTGG
ACCCTCAGGGGCAGATGGACCACACAGACTGGGATCGCCA
GTGGACCCTAGGAAGGTGCTGATTGTCGCTGGACATCATA
ACTGGATTGTAGCTGCTTATGCACATTTTGTCATTTGCTA
CAGGATAAAGGAATCCTCAGGCTGGCAGCAGGTGTTTTCC
AGCCCTTACCTGGAATGGGCCATTGAGCGTGTGGCTCTCA
ATGCTAAAGTTGTTGGCGGACCACATGGCGATAAAGACAA
GATGGTGGCGGCATCATCAGAGAACAGAATAATATTGTGG
AGCATCCAGGATGGAGGGAATGGAAGTGAAATAGGAGTGT
TCAGTCTTGGTGTACCTGTTGATTCTCTATTTTTCATCGG
GAGTCAGCTAGTTGCCACCAGTCACACGGGGAAGGTAGGA
GTTTGGAACGCCGTCACACAGCACTGGCAGGTACAGGATG
TGGTGCCCATCACAAGCTGTGACACTGCTGGCTCTTTCCT
CTTGCTGGGCTGTAACAACGGCTCCATTTACTATATTGAC
ATGCAGAAGTTTCCGCTGAGAATGAAGGACAATGATTTGC
TGGTGACAGAGCTGTATCACGACCCTTCAAATGATGCCAT
CACGGCCCTCAGTGTCTACCTGACTCCTAAAACCAGTGTG
AGTGGGAACTGGATTGAGATCGCGTACGGGACGAGTTCAG
GGGCCGTGCGTGTCATTGTACAGCATCCAGAAACGGTTGG
GTCAGGTCCACAGCTCTTCCAGACCTTCACTGTTCACCGT
AGTCCCGTCACTAAGATCATGCTCTCTGAAAAGCATTTGG
TTTCAGTGTGTGCTGACAATAACCATGTACGCACATGGAC
GGTGACGCGGTTCAGAGGCATGATCTCCACTCAGCCAGGA
TCGACTCCGCTGGCCTCATTTAAGATCATCTCGTTGGAGG
AAACAGAAAGCCACAACAGCTATTCCTCTGGAAATGACAT
CGGCCCATTTGGAGAAAGAGATGACCAACAGGTGTTCATT
CAGAAAGTCATTCCCATCACCAACAAACTCTTTGTTCGTC
TGTCCTCTACAGGAAGGAGGATCTGTGAGGTGCAGTCAGT
AGATGGGACCACTATCACATGTTTCACAGTGCGAGAGTGT
GAGGGTTCGAGCCGCATGGGCTCCAGACCACGACGTTACC
TTTTCACTGGCCATGCCAACGGGAGCATCCAGATGTGGGA
CCTCACCACTGCCATGGACACGGCCAACAAGAGTGATGAC
AAAGCCAAGCGGGAGCCAGAGATGGGAGGTCCAACAGAGG
AGGAGTTGCTGAAGCTGCTTGACCAATGTGATTTGAGCAC
GTCTCGCTGTGCCACGCCCAACATCAGCCCCGCCCCGTCG
GTACTGCAGCACAGCCGACTACGACAGTCCTGCTCCAGTC
TCCAGCTTCAGGCTCAGGAGCCCATCCCTGAGACAGCCAC
CTATGGAGCCCTGAGGCCATACCGTGAGAGCCCTCTGCTG
GCCCGCGCTCGACGCACAGAGAGCTTTCACAGCTACCGAG
ACTTCCACAGCTTGAACCTGACCAAAGCCTTGCTGGAGAA
CCACAGCCAGTGCGCATCCACCGAGGATGAGATCCGGCAG
TCTGTTGGGGAAAACATCACTGAGGACACAGACAAACGAA
ACTCAACTATTGATCTCAGTACATCAAGAGCATCCGAAAC
ACACCCTGCAGTAACGCGTAAACCCCCCGACAGCCCTGGA
GACCAGAGGCGCAGAGCTCATCTAATGGAGGAAGGAGCTG
CGGACTGCAGGAGAAGAGGGACGTTTGAGGCTAATTTTCT
AAGCAGGAAAAAGGCTCCTCCAGTTTCAGAGCTCAGTCCT
CCACCTGCGGGAGTTGATGGAGGCGGCAGTGACTCGTCCA
GCACCGCTTCACCCTCGCCAACTAAACTGTCCACTTCCCC
ACGCCACCGAAAGCCTCCCGATTCTGCATGTGAGTGATGG
TTTACAGTGATTCGTCATACATAAAGATCACACCAAATAC
CATAATCTCTGACAGGGAGAAGAAGGTAGATGAAGGGAGG
ATTTCAGAAGAGAAGGATTTGAGGATGTAGTTGTGAAGAT
CTGACAGCTGGCAGCTAAAAAAAAAACTCACTGTGGACAG
ATTTAAAGGGAAAACGCACACTCACAGTACAAATTCACCA
CACTTTTTCATGCCTCTTTAGCTTTTGTCAGTCTTCAAAT
GTTGGCTTCATTTTTCTTTTCACATTTCCAAGCTTGAAAA
ATCAAATCATTTGCCTAAACTTGTCATCCCCTGGAGCAAA
AAAACAAAACAAAAACAAAACAAAACAGTAGATGCAATCT
GTTTAATTCAGTCATCTAGAATTTAGAACTGCAAAATTTT
ATAGTTTACCTTTTTTAAGTAAACCTTAAAATGAAAATGT
AATCAGTTTAAACTATCTTAAACTATCTAGTCACTAACTT
AAAATTTAAGTTTTTTAGTCATTTTAATGTCAATAAAAAC
CTAAAGGGATGTATTTCACGGATCAAGACAGGGAAAGTTT
ATCAGAATGTCTGACCCGCTTGCTTCTATCAAATGAAAGT
GGACAGAGACTGGGGCTTCTCAAACTCTACAAAGACTAAA
TAAAGCAGTATTTATATAGTATTATAATCACTGATTACAG
ACGCAAATGCCCTTTCACACAGGGCATCAGTGTTAACGCT
TCCCATTCATTTTGAATAGGTGATGTC

kctd3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA kctd3-201 3547
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kctd3-201 Contained in:
[BAC] DKEY-46N18 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000011313 (1),  Ensembl_Trans:ENSDART00000086164 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH609425 (1) 891 nt
GenBank:EH591923 (1) 782 nt
GenBank:GO941081 (1) 766 nt
GenBank:BE557597 (1) 640 nt
GenBank:EB899313 (1) 552 nt
CITATIONS (2)