ZFIN ID: ZDB-TSCRIPT-090929-19418
Transcript Name: ponzr6-201
Previous Names: ponzr6-001, si:dkey-165a24.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039114 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039114|OTTDARG00000028643|ZDB-GENE-081104-326 ponzr6|OTTDARP00000031297 DKEY-165A24.5-001 LG_ BX470211.11 Danio rerio protein_coding NOVEL, 781 bp
GTGCATCAGCAAGCACTGCTCCACACCCTCTGAAGACCAG
GCTGCAGGTTATCTGAATAGTCATGATGGCTCAGGCAGTA
AGTGTCCAGCCGGCGATGGTGGTGGCCACTGATAATGTCA
AGCTGAACCAGTGGAGCAGTGGTGTGTGTGACTGCTGTGA
AGACATGAGCATCTGCTGTTGTGGTTTCTGGTGCGCTTAC
TGCCTGATGTGTAAAACCAGTGAGGATTTCGGAGAGTGTC
TCTGTCTCCCCCTGCTGGAGATTTGCTTTGGAGGCATGTT
GCATCCTATTACACTCGCCATGAGGAGCAGTATGAGGGAG
CGGTACCACATCAGGGGATCAATACAAGATGACTGCTGTG
CGGCGACCTGTTGTCCAGTGTGTGTCTGGTGTCAGATGGC
CAGAGAGCTGAAGGTCCGACAGCACTCTCTAGTGGTCATC
AACCCTGCCGTCAGCCAAGTTCACGCCGTCAATGTGGCCT
ACCAACCTCCTCAAGCCATCAATCCTGCCTACCAATAGCC
TCAGTGCCAACATTTATCCTTAAGACACCCCAAATGCCTT
TTGTTTTGCTGAAATTGCATAGTGCTGAATAGACATTATT
TCAATATTTATACCTAAAGTCTAGCTATCTTTGCCAATAT
GTTTACTGAATGTGAGATTATATTATATTATATATATATA
TTTAGTAATTTTCTCTAAATGCAAAATGCCAAATACAGTT
TTGAATATATTAAGTGATTGAGTGTACACATATTTAACTA
AATAAATAATATATTTCCACA

ponzr6 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ponzr6-201 781
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ponzr6-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000039114 (1),  Ensembl_Trans:ENSDART00000137203 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CO917023 (1) 854 nt
GenBank:EH474754 (1) 765 nt
GenBank:EB986464 (1) 671 nt
GenBank:CF103324 (1) 617 nt
GenBank:CF102201 (1) 593 nt
CITATIONS (2)