Transcript

spsb1-201

ID
ZDB-TSCRIPT-090929-19360
Name
spsb1-201
Previous Names
  • spsb1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039054 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039054|OTTDARG00000028620|ZDB-GENE-030131-6122 spsb1|OTTDARP00000031252 DKEY-237G3.1-001 LG_none CT027629.6,CR388207.13 Danio rerio protein_coding KNOWN, 2524 bp
AATACAAGCCTCTATGCTAAAACAGACACGGAGAGGACAT
ATAGCCATGGATTTGCACGGGGATACCGACTAAAAGAAGC
ATTCTCGCTCCACTCCTTTGCCTATGGTTGGTTTTCCGGC
GTGTTTCCGTAGCAGGTGAGCTCAACTAGCTGCTGGTCTG
ACCTGGTCTCCCAACAACCATTGGCATAAAAACATTGGCC
TTGGCCTCTTTCCTACTGGAGGGGCATAGGTGAAGGAGTG
GACCAGGCCTCCTCTCTTAGTCTGCCATTTACTTAATTTT
GTGTCAAGAGGTGGATTGAGGTGCTTAGAAGACCACCCAG
AGCATGGGGCAGAAGGTTCCGGGAGGCATAAAGACGGTGG
ACATGCGGGACCCGGCGTTTCGGCCCCTCAAGCTAGAGCT
GCAGGCCCTGGATTACACCAAACCATCCCGCCTGGATATG
TTGTTAGACATGCCATCAGCCTCACAGGACATCCAAGTGC
AACACTCGTGGAACAACGATGACCGATCGCTCAACATCTT
TGTTAAAGAGGACAATAAACTCATATTTCACAGGCACCCT
GTAGCACAGAGTACAGATGCCATCCGGGGCCGAGTGGGAT
ACACACGGGGACTGCATGTTTGGGAGATCAGCTGGGCAAT
GCGCCAGCGGGGCACTCATGCTGTTGTTGGAGTGGCGACA
GGTGAAGCCCCATTGCATTCAGTAGGATACACTGCACTTG
TAGGAAACAATAGCGAGTCCTGGGGCTGGGACCTAGGACG
GAACAAACTCTATCATGATGGTAAAAACCAGCCCAGTAGG
ACATATCCAGCTTTTCTTGAGCCCGATGAGACGTTTATTG
TGCCAGACTCATTTTTGGTGGTCTTGGACATGGATGAGGG
GACTTTAAGTTTTATCGTTGATGGACAATATTTAGGGGTT
GCTTTTAGAGGACTCAAAGGAAAGAAGCTATACCCTGTAG
TGAGCGCTGTGTGGGGACACTGTGAAATCCGAATCCGGTA
CATCAATGGACTTGATCCTGAACCTCTGCCATTAATGGAC
CTCTGTAGGCGCTCTGTACGGGTGGCATTGGGAAGAGAAC
GACTGAGTGAAATCCATGGACTGCCCTTACCAGCCTCCCT
AAAGAACTATCTACTCTACCAATGATGATAGTAGTGCCTT
TACAAGCATTCAAGGCATAGCAACTGCCTCGGATTCTCTC
TGGGATAAATAGTCTTTCTGGCAAGCCTGTTTCATCATAG
TTCTTGGTACCAACGATACTGTTTTTACAAATCCAACCAA
GGACACCTCATGCTTGATGCTTTCAGGATCAAGCATGGAT
TCGTCTTTTGCTTCACTCATGTACTGGAAATCAAACCGGA
GGCTTAGGCCAGAATCCTGTGGCAGATTTGAAAACAAGAA
CCCTTCTTCTCTCTAATCATGGCTTGGTAACTTCAGCTGT
TAAAGGCCTTTTTACTTTTTATGATTTTTTTTTTTTTTAC
TCCATCCCCTTTTTTAATGATGTATTGGCATACCTTAAGC
TTTCTTGTATCATGTCATTAGCTTGTGGGTCCACAAGGCA
ACTCTTTGTGGCCAATGCAAAACAAATTCCATCTCAAGAC
CGTTAAACTTAACAACCAAGTTTTTAAGTTAATATTGACT
TTTTATATATTGCGCTTTTTAAATTATCCCATTGCAGTCA
GTATACTGTAGTAGCTGAGTCCACTTCAGATCAGTAGCAG
CGGTTAGCATTTTAGCTAATGGAAGGCGAGGTCTCCCCCT
GCACACTCTTGGCAGGTTAAAAATAGCCTGGTTTTAGCTG
TAAGTCTGACCGTCTGGCCTGGAAAAACAGTCGTTGACGT
CTGTGAGAGGGGGGGAGTTTAGAGGCTAGCATTCATGGAA
ACGGCCACTGCTAGTGTGCTATGCTAGCTCTTTAAAACCA
CTCAACGGGTCCCTCGCCTCTATTCACACTGCAATATCAG
AAAGTGCCTGGCTCAAAATACTGATACATTAGGAGAGAGC
CATGATTTGAAGTCCTTTTTATAATGAATGAAAGATGTCA
TCACTGTGAACCTATGTAGCATACGTTGATCAATAAGAGG
TTGTACAGCTTGCTTTGTGTAATGGCCCCTAAATCCTGTG
AACACCCACATTGGCAATTTAGTTTTTATCTTGAGGACTG
TTTTAATCTGTTGATGATTTGGGGAAAGCAGGAATGGAGT
AGTGACACTGCTGTGTGGTGCCTTGTCTATGAGTTAATGA
GTGAAACGTGGGCAAATGTTGATGCTCTATTTCTTAAGTC
TTGATGCTGAGAAGGTAAGATTGCCAATTGTTGTTTTTCT
GTGTTTTTTTCCCCCCTCCCTATTCTAGTATTTTTAGATG
TGTTAATCTAGTTCATGTTTGGCAGCCATTTTGCTAAGCA
TGAGGGGGATAGTTTGGTTGCCTGTTTTTAAACCCTTTCT
GCCTGGAGACCACCATTCTCTTTGTATTAAGTGATGTAGA
TAATATTGGTAACTATCTAATAAAGTTTATTATAATTTAA
AACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations