ZFIN ID: ZDB-TSCRIPT-090929-1933
Transcript Name: bzw1a-201
Previous Name: bzw1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011238 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011238|OTTDARG00000009786|ZDB-GENE-030131-3951 bzw1a|OTTDARP00000009666 bzw1-001 LG_ BX649296.3 Danio rerio protein_coding NOVEL, 2050 bp
CAGCAGTCCCTTACCATCCGGGAGAGTTTGTGTGTCGGGT
TCGGACCTGCCATTGTCTTGCTTTGTTCTTGGGTTCAAAA
AGCCGTTTTTTATCTGCATTCATTTCGGTGTCTTTTATGA
ATAATCAAAAGCAGCAAAAGCCAACGCTTACCGGCCAGCG
TTTTAAAACTCGGAAAAGAGATGAAAAGGAGAGATTTGAC
CCTTCTCAGTTTCAAGAAAGTATTGTTCAAGGCTTGAACC
AAACTGGCACTGATTTGGAAGCGGTTGCAAAGTTTCTTGA
TGCCTCCGGCGCCAAGCTCGACTACCGTCGGTATGCTGAG
ACACTCTTCGACATCCTGGTGGCTGGAGGAATGCTGGCCC
CGGGAGGGACTCTTTCTGATGACTTGACTCGTACGGAGTA
CTGCCTCTTCACGGCAAGTGAAGACCTGGAGACCATGCAG
GCTTACGCTCAGGTTTTTAACAAGCTGATCAGGCGTTACA
AGTACCTGGAGAAAGGGTTTGAAGAGGAGATTAAGAAGCT
GTTGCTGTTTTTAAAAGGGTTCACTGAGTCTGAAAGGAAT
AAATTGGCCATGCTTACCGGAATCCTGCTGGCCAATGGCA
ATATATCCGCCTCCATCCTGAACAGCCTCTTTAATGAGAA
CTTGGTTAAGGAAGGTGTATCTGCCGCCTTCGCTGTGAAA
CTGTTCAAATCTTGGATTAACGAAAAAGACATCAACTCAG
TTGCTGCTAGCCTGCGTAAAGTTGGCATGGACAACAGGCT
AATGGAGCTGTTCCCTGCCAACAAGCGTAGCTGCGAACAT
TTCTCCAAATATTTCACCGACGCTGGGCTGAAGGAGCTTT
CTGACTTTGCTCGCAACCAGCAGTCCATTGGAGCACGCAA
GGAGCTTCAGAAAGAGCTGCAGGAGCAGATGTCCCGTGGC
GAAACTCTCAAAGATATCATTGCCTACGTTCGTGAAGAGA
TGAAGAAAACTAGCATCTCCGAGCAGACAATGATCGGCAT
CGTGTGGACCAGTGTCATGAGCTCCGTCGAGTGGAATAAA
AAGGAGGAGCTCGTCACAGAGCAAGCCATCAAACACTTGA
AGCAATACAGCCCACTGCTGAAGGCCTTCACCTCACAGGG
CCTGTCTGAGCTCACACTCCTGCTGAAGATCCAGGAGTAC
TGCTATGACAATATCCACTTCATGAAGGCCTTCCAGAAGA
TCGTGGTGCTTCTTTACAAAGCTGATGTTTTGAGTGAGGA
GGTGATTTTGAAGTGGTACACAGAAGGCCATGTGGCCAAA
GGAAAGAGCGTCTTCCTTGAGCAGATGAAGAAGTTTGTGG
AATGGCTGAAAAACGCAGAAGAGGAGTCTGAATCTGAGGA
AGAAGAGGGAGACTAAAATACCATGTCAGCAGAATGTTTT
GTTACAGAAGTGCTTGTCTTTCTATTTTTTTTATTTTATT
TTTTGCTTTTTTTTTTTTTTTTTTTTTTTTTGATTCTACC
TCCTGTTTTTTCAAACCATAACATTTAGATGTCATTTAAG
GGCTTTATAACAAATGGTTAATTTTAACAGATTTTTCTAA
TAAGGTTTACACTTAAGATAGCACAAAAGTTGTGGTCAAC
CTTTGTAATTATTTACTCACTCAAGGAACTTTTAAGTGTT
GACACAGTTCGGACATCTTAAATTATTGTTCTAGTGATTC
CTTTATGAATTGACATTCCATTGAATTAGATCAGGCTGCC
TTGTTTGCTTTTAAGACGCCCTTTTCTATATGGTATTGAT
GCCTTCATGCCCTGTCATGATCAGTGTTCCACAAAGGGAA
TAAACGGTCCTCTTTGTCTCATCGTGATGTTATTGCCAAA
GGGTTGAGTCCTTCTCCCATAACATCCATCGGCGTTCTGT
TCCCTGCCTATCAAACTGTACAGCGCTGAAAACAATTTGC
AGATCACCTGTAAAGACCCTTAAATGACTCCCAACCTCTT
CTATGATGTACCTCCATCTTATTCGTCACCAGTTTCTTTA
ATCTGACAAACTAATTGACTTTTTTTAAGAAATAAAGATC
TAGAAGTATA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bzw1a-201 Contained in:
OTHER bzw1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000011238 (1)
  • Ensembl_Trans:ENSDART00000013575 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC058875 (1) 2096bp
    GenBank:CA471744 (1) 908bp
    GenBank:CA787504 (1) 908bp
    GenBank:CA471746 (1) 902bp
    GenBank:CA475141 (1) 871bp
    GenBank:BI704321 (1) 718bp
    GenBank:BQ259686 (1) 633bp
    GenBank:AW184440 (1) 521bp
    GenBank:AW128145 (1) 517bp
    GenBank:AW421708 (1) 485bp
    GenBank:CB354296 (1) 434bp
    GenBank:BM572987 (1) 421bp
    GenBank:AW778616 (1) 301bp
    CITATIONS (2)