Transcript

si:dkey-14k9.3-201

ID
ZDB-TSCRIPT-090929-1932
Name
si:dkey-14k9.3-201
Previous Names
  • si:dkey-14k9.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000011233 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000011233|OTTDARG00000009781|ZDB-GENE-030131-2893 si:dkey-14k9.3|OTTDARP00000009662 DKEY-14K9.3-001 LG_ BX649347.3 Danio rerio protein_coding NOVEL, 1296 bp
ATGGACAATAAAATCTCCCAACAAGAGCACTTTGAAGGTC
CTTCCAAGCTCCTCTCCTGCTCGCATTGCCCGTTCACTAA
CTCTAAAGAGGAAAACCTTAGGGAGCATGTAAAGAAAGTC
CATTCCACTGAGGTTACGGAAACCGAGACCGCCGCTGATC
CCAGTTTGTCCTGTAAATGTGATGTCTGTGGCCGAAGCTA
CCGATTCTCTTTCTTATTGAAAGCTCACCAGCGGATTCAC
TCCAAAAAGCATCCCGTATCTAAACGCAGCAAGAGTTTCT
CCCGTTCCCAAGCCGCGCATCAGCATGGACCTGCTCCTGA
AACATCATCGCAAGATGATGCTGAGGAAAACACTCGACAA
AAGAGCTACAGCTGTCTCTACTGCAGAGAAACCTTCAGCT
CACTCAGCGCCAGGAGAAACCATCACAGAACCCATCCCGA
AGAAACCTTGAATCAATGCACCGCCTGCGGGAAGAAGCTC
AGCAGTCAAGCGGCTCTTAAAAGACACAAGCAAATCCACG
AAGAGAAGCAATCCTATAATTGCTCCAAATGCAAGTCCAC
CTTCATCTGCTCGACCTCTTACAAACAGCACATGTTGACG
CACGAGTCCGAAAGACCCTTCGTTTGTACCTGTGGAAAGG
GTTTTAAATATCGCGGTGCTCTTTCGGCCCATAAACGCAC
TCATACTGAAGATAGACCATACCGTTGTTTAGACTGCGGA
AAGGGGTTTTTATATCCCGGAGCTTTGACGACGCACCAGA
AAAAACACTCTAAAGGTAACCCAGAGCATTGCACACAGTG
TCACTCCAGTACGGAAAAGTGTGTTTGCTCCCAATCGCAA
GCGGAGAAGTCTTTCAAATGCCCCACATGCGATAAGTTGT
TCGCGTTCAAGTCCAGCTTAATCCGGCACAAACTCACACA
CACCGGAGAAAGACCGTTCCTTTGCTCAGACTGCGGGAAG
GGCTTTTTAACTTTTGGTGAGCTGCTGAAGCACCAGCGCT
ACCACACGGGGCACAAACCGTTCCAGTGCACCGACTGTGA
AAAGAGCTTTACGCAGGCCTGCTACCTGCAGGTCCACATG
AGGCAGCACACCGGCGTACGGCCCTATTCCTGTTCCCAAT
GCGACAAGAGTTTCTACAGTTCGTCCCATCTCAAGAGGCA
CCTGCGGATTCATTCGGGGGAAAAGCCCTTCGAGTGCTTG
GATTGCGGGAAGAGATTTCCGCAGCCGTATCATCTGAAAG
TGCACTTCCAGACTCACATGCAAAAGAAACCCGAAAGCAA
GAAATCCAATGAATAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations