ZFIN ID: ZDB-TSCRIPT-090929-1932
Transcript Name: si:dkey-14k9.3-201
Previous Name: si:dkey-14k9.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011233 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011233|OTTDARG00000009781|ZDB-GENE-030131-2893 si:dkey-14k9.3|OTTDARP00000009662 DKEY-14K9.3-001 LG_ BX649347.3 Danio rerio protein_coding NOVEL, 1296 bp
ATGGACAATAAAATCTCCCAACAAGAGCACTTTGAAGGTC
CTTCCAAGCTCCTCTCCTGCTCGCATTGCCCGTTCACTAA
CTCTAAAGAGGAAAACCTTAGGGAGCATGTAAAGAAAGTC
CATTCCACTGAGGTTACGGAAACCGAGACCGCCGCTGATC
CCAGTTTGTCCTGTAAATGTGATGTCTGTGGCCGAAGCTA
CCGATTCTCTTTCTTATTGAAAGCTCACCAGCGGATTCAC
TCCAAAAAGCATCCCGTATCTAAACGCAGCAAGAGTTTCT
CCCGTTCCCAAGCCGCGCATCAGCATGGACCTGCTCCTGA
AACATCATCGCAAGATGATGCTGAGGAAAACACTCGACAA
AAGAGCTACAGCTGTCTCTACTGCAGAGAAACCTTCAGCT
CACTCAGCGCCAGGAGAAACCATCACAGAACCCATCCCGA
AGAAACCTTGAATCAATGCACCGCCTGCGGGAAGAAGCTC
AGCAGTCAAGCGGCTCTTAAAAGACACAAGCAAATCCACG
AAGAGAAGCAATCCTATAATTGCTCCAAATGCAAGTCCAC
CTTCATCTGCTCGACCTCTTACAAACAGCACATGTTGACG
CACGAGTCCGAAAGACCCTTCGTTTGTACCTGTGGAAAGG
GTTTTAAATATCGCGGTGCTCTTTCGGCCCATAAACGCAC
TCATACTGAAGATAGACCATACCGTTGTTTAGACTGCGGA
AAGGGGTTTTTATATCCCGGAGCTTTGACGACGCACCAGA
AAAAACACTCTAAAGGTAACCCAGAGCATTGCACACAGTG
TCACTCCAGTACGGAAAAGTGTGTTTGCTCCCAATCGCAA
GCGGAGAAGTCTTTCAAATGCCCCACATGCGATAAGTTGT
TCGCGTTCAAGTCCAGCTTAATCCGGCACAAACTCACACA
CACCGGAGAAAGACCGTTCCTTTGCTCAGACTGCGGGAAG
GGCTTTTTAACTTTTGGTGAGCTGCTGAAGCACCAGCGCT
ACCACACGGGGCACAAACCGTTCCAGTGCACCGACTGTGA
AAAGAGCTTTACGCAGGCCTGCTACCTGCAGGTCCACATG
AGGCAGCACACCGGCGTACGGCCCTATTCCTGTTCCCAAT
GCGACAAGAGTTTCTACAGTTCGTCCCATCTCAAGAGGCA
CCTGCGGATTCATTCGGGGGAAAAGCCCTTCGAGTGCTTG
GATTGCGGGAAGAGATTTCCGCAGCCGTATCATCTGAAAG
TGCACTTCCAGACTCACATGCAAAAGAAACCCGAAAGCAA
GAAATCCAATGAATAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-14k9.3-201 Contained in:
[BAC] DKEY-14K9 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000011233 (1),  Ensembl_Trans:ENSDART00000137829 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AI658289 (1) 496 nt
CITATIONS (2)