Transcript

cfap126-201

ID
ZDB-TSCRIPT-090929-19260
Name
cfap126-201
Previous Names
  • cfap126-001
  • zgc:152916-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038933 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038933|OTTDARG00000028539|ZDB-GENE-060825-357 cfap126|OTTDARP00000031157 DKEYP-1G12.2-001 LG_ BX323050.6 Danio rerio protein_coding KNOWN, 1662 bp
GTTTTCTTCAGCTGTAAAAGAGATTATTTAAAAATATTCT
ATTACGTACGGCGTTTTTTAAACCGCCAAATAACTTTTAA
GAGTGAGTAAACTCCTATCTCCTGAGATAAAACTGTATTT
TTACCCTTGATATTTTGAAAGGTTGCTAGGAGACCACTGC
CAACACAGCCGTGAGGAAACATGTCGACAAGTTACTCTGC
AAACCAGTATGAAAGCGCTTTTAAGTCGCAAAAGCTCCAG
AACTGGACCATCCCAAAGCAATTCAAAGAGAGACCATCAG
CAGCAGAAGGCTACACTACATTCATAGCCACAGACCGTGG
TCACCTTCTACCAGGTGTAAGAACAAAGCATCGAAGTGCG
TGGCCAGCATTCCAAGGCACATGGGATTTACCACGTCGTA
TTCCTCCTGTTTCCATGAACCCCACTGCTCGCTCACAAGT
GGGCCAGGACCGTCTCATGACCTGGGGACAGATGAAAATC
ACAACAAAGCAGGCTCACGAGGGCCCTGGTGACAGTCAGG
CTATGAACAGAAACTCTCATGATGTGGAAAACATAAATGT
GGATCAGCCTGCTGAACAGTCAAAAATATACATTGACCCA
GATGAAAATCAACCAGAGAAGCCTAAATCACAGCATATCC
AGGACCAGTCAAGACCAGCAAGCCAGCAGGCCCAGCCTAT
CCCAGAAAACCTTAATATAAACCAGTCTAGACCAGCAAGT
CAACGCAGCCAACAGGCTCCATCCAGACCAGCCACTCAGC
AAAACCAAGCTGAATTCAGACCACCAACCCACAACAGCAG
ACCAGCATCTCAAGAAAAATAACACCAATTATAATCAGAT
CCCCTGCATGGGCAGTTATAAAAGTTCTTCCATGAAATGG
CATTACGCAAGTGCAACACTTCTTTGAAAAACACTTTTGC
TTCCCCAGATATTATTCTCGCATTTCCGTTGATTTAGAAC
TGTGCTCCCAGATTGTGCATAACGTGTGTCAGAACACATT
AACTGAATTGTTTCATTGAAGCTAAAGCTGATTAGTTTTA
ACTAAATGGCTTTTGTATTGGGATCAGCTTGAATTAAATG
CTGTCAATGAATGAAATGCAGGGTCAAGTATTACTAGAAA
AATCACACATAAAATCTGAATTGAATCATATTCTTTTTTT
TAAATGATAAAAACGGCATAGATTTGAAATAATTTTCTTT
ATTTGCTCAGTAATGAACAGACACACCTGTAAGCCCCTAT
AACACAACATCAGCTTGATTCACTAGTCGTCGGTTTATGC
TTTTGGTGCTTGGAAGCAAATGATTGATTTTGGGAGCAGA
CACTGAAAGATTGTGGATGTGATGGTCCACATAAAAATGA
AAACTCTGTCACCATTTACTTACAATCATGTCATTGCAAA
CCTCTTCCATTTTCTCTGGAACATACAGTAAAATATTATG
AGGATTGTGTCCATTTAATTAATTAAATCAAATGCTCAGA
TTGTTTCAGATATCAACATTTTGGTTCAGCTAAAGGATAT
TAGTCACACAGATTCAGAATGACATGAAGTAATCGATGAC
AGAGTTTACGTTTTTTTTCCCTCTGAACAAAAGTCAAAAA
TAGCAACGCATTTTTCTCTCTCTTGTGATAAATGCACAAT
AAACAGCTGTATGGTCATGCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations