ZFIN ID: ZDB-TSCRIPT-090929-19147
Transcript Name: adat1-201
Previous Name: adat1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038797 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038797|OTTDARG00000028477|ZDB-GENE-070410-64 adat1|OTTDARP00000031075 adat1-001 LG_ BX890570.11 Danio rerio protein_coding KNOWN, 1590 bp
AATTGCTTTAACCAGCCAGTGTCAATAACTCGCACGTGTG
AGTACAAAAATACTGCAAAAACAGTACAGTACACGGTCAG
TTTCGTCGTACATTTGTTTCCCCTGTTCGCGCTTAAGAGC
AGAAGATGTGGAGTCCTGATGAAATAGCCAGTCTGTGTTA
TAATCACTTTAATAAACTGCCCAAACGAGGGAAACCCGAG
TCTGGCAGAGAGTGGACTTTACTAGCGGCTGTCATTCAGA
TCACAGACTGTCCAGAGCAGAAAACAGTCCAGAAGCAGGT
GGTGTCTTTGGGAACCGGCACGAAATGCATCGGCCGCTCG
GCGATGAGCATGAAAGGCGATGTTCTGAACGACAGTCACG
CTGAGGTTATCGCACGCAGAGGATCTGTCCGGTATCTGAC
GGAGCAGCTGCTCAAGGCTGTGCGCGGTCAGAGCTCTGAT
GTTTTCTGTGCAGGATCTGAAAAGGGAAAATGGAGGCTTA
AAGCAGGAGTCTCTTTCCTCTTTTTCACCAGTCAAACACC
CTGTGGCGATGCCTCCATATTTCCCATGTCTGGCAGTGAA
GCTCAGCCTTGTGAACCAGTGAAGGAAACAACCCAGAATG
ACGAGTCAGAGCCACGAGGCCTGAAACGACCCGCTGACCA
GGAGACCAGGCAGAAAACCAAACATCCCAAAATCAAGACT
AGCGACAAACAGCCATCTTGTAGGAGTTCAGGAGACACCG
AGGACAAAGCTGAAGCAGAAAATACATCCTGCAGTGAGCG
GAGTGAAGCCGAGCCGCTGGACCTGCACCGCACCGGGGCT
AAGAGTGTCCCAGACGGCCCTAAAGATCTACTGCAGCCAG
GGCTGCTCTATCACCACACTGGGCTCCTGCGGGTCAAGCC
GGGCCGTGGAGAGCCAACGCTGTCTCTGTCCTGCAGCGAT
AAACTGGCCCGCTGGTGCATTCTGGGATTCCAGGGGGCGC
TGCTGATGCATTACCTGCAGGAGGCGCTGTACTTCAGTGC
TGTGCTGGTGGGGAAGAGTCCGTACAGCCATCCAGCCCTG
CGGAGAGCGCTACACACACGTTGTTCCCATGTGAAGGATT
TGCCGTCTGGTTTCTCCTTCCATGATCCGGAGCTTCTTCA
GTCCAGCCTGGAGTTTCCTCACAACCACACACACACCGAA
TCCAAACACACACACTCGCAGGGCCGAATATCTCCATGCG
GAGCAGCCATCAGCTGGTGTGCGGTTTCCCAGCAGCCTCT
AGATGTCACCGCTAACGGCTATAAACAGGGAGTCACTAAA
AAAGCTTTGGGCACACCACAAGCCAGATCTTTAATCTGTA
AGGTGGAGCTCTTTCATTCGTTTCTGAAAGTGGTGGCGGC
CACTGAAGACGCTGAGCTTCCAGAAACCCTCCGTGGAAAG
GACTGGAAGACGTACTGGGACTATAAGCAGGCGGCAGGGT
CGTATCAGCTGGCCTGGACACAGCTGCGTCTGCAGGCCTT
CCCTCAGTGGCCCCGCGGGCCCCGACAACTGCTGCTGTTT
CAATAGAGGAATGGCCAAGCCAACACTGGAGCTTCAACCA
CTGAAGGTTTAATAAATGTATTCACATTCA

adat1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA adat1-201 1590
ncRNA adat1-002 (1)    Ensembl 600
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
adat1-201 Contained in:
[BAC] DKEYP-7F1 (1)

Genome Resources: Vega_Trans:OTTDART00000038797 (1),  Ensembl_Trans:ENSDART00000087410 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC133939 (1) 1614 nt
GenBank:EE694639 (1) 906 nt
CITATIONS (2)