Transcript

tes-201

ID
ZDB-TSCRIPT-090929-19028
Name
tes-201
Previous Names
  • tes-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038678 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038678|OTTDARG00000028417|ZDB-GENE-040718-59 tes|OTTDARP00000030983 tes-001 LG_ CT573397.14 Danio rerio protein_coding KNOWN, 2077 bp
CTCCGCGTGAGTGAGTGTGAGCAGAGGGACGGAGGTGCGA
GATTCACTGTCCCGTTCAACATCAGTGACCCGTCAGGAAA
AGTTACCGGTGGAGACAGAGTCAGCGCTGGTTATCATATT
TAATAAAGCACGACAAGAATGGAGATCGAGAAGGAAGTTA
AAAAGATAACTCTTGGCCATGAGATTGGAGCTGGAGCTGC
CTGTCTGAAATGCAAGGACAAGTGCGAAGGTTTCGAGCTT
CACTTCTGGCGAAAGATTTGCCGAAACTGCAAGTGTGGTG
TTGAGGACCATGACGTGCAGCTGGAGACTGAAGAGAGCAA
GAAAGTTGGGAAGCTTTTTGAGGACACCAAGTACACGGGA
CTCATAGCCAAGCTGAAGAGAGATGGCATTCCTTCTTATA
GAAGCAACCAGTTCACCGTCTCCGTCCCAGCGGCTTCCCT
CAGCAGTGCTACTGCTGTTCCTGCTGGGGTTTTCATCCCA
GGCTCCAACCAGACCTTCAGCTCCATCACTCCACCTGGTC
ATGCCCCGTCTGCTGCTGCTGCAGGTACAGGGGGTGCTAG
TAACCCTCCTGGTGCTCCAGGCATTGCTCCCACTGCTGTC
CCAGGAGCAGGTCGCACTGCTGGGTCTGCAGGGTCAGGTT
ATGGTGGTGGGGTTTCCTCTGGTGCTGTACCAGGTAAAGG
TCTCAGTGCTGCCACTATTGCAGTACCAGCTCCCACTGCA
GTGCCTGCTAAGACAGACGTGGTCAAGTCTGTTACCTATG
AATGGGCTCCACCTGGGATTAACCAAAGTTTGGCTCTGCG
GTACATGGAGCTTCTTCCTCCAGAGCAGCGGCCCATCGCT
GGTACAACAGGAGCAGATTACCGTAAGAAGCAGATGGCCA
AACAGCTTCCAGACCATGACCAAGACCCCGAGCGCTGCCA
TGAGCTTTCACCCGGAGAGATCAAGCAAATGCAGCAGTAT
GTGCGAAAATACAAGGACGAGGCGCTGGGTATAGGTGACA
TCACCCTGCCTGAAGAGATGGGGCAGGTGGGTGCAGCTGG
AGATAAAGGGCCTCAAGGAGTTGGTGCCGGAGGAAAGCCT
GGTGCCGGTACAACAGGGGCTTCAGGAGACAAAGGTGATG
CTGTTGCTACAGTGGGGAAAGTTGGTGCCCCAGGGGCTGC
TGGGACATCAGCCGGTGGACCTGCTGGTAACTTTTCCTGC
CACCAGTGCCAGAAGCCCATGAAGAAGGGTGAGCCTGCTG
TGTTTGCAGAGAGGGCCGGTTATGATAAACTCTGGCACCC
AGCATGTTTCGTGTGCTGCACCTGCACTGAGCTTCTGGTG
GACATGATCTATTTCTGGAAAAAGGGTCAGCTTTACTGTG
GCCGTCATTATGGAGACAGTGAAAAACCAAGATGTGGAGG
CTGTGATGAGCTCATCTTCAGTAATGAATACACTCAAGCC
GAGGGCCAGAATTGGCACCTGAAGCACTTCTGCTGTTTTG
ACTGTGACTGTGTGTTGGCTGGAGAGACCTACGTCATGGA
GAAGGAGAAGCCTGTTTGCAAACCCTGCTACATGAAGAAC
CATGCTGTGTGTTGTGTGGCCTGTCAGAAGCCCATCGAGC
CTGAATCTCAGCGTGTGTCGTATGGAGAGCATCACTGGCA
CGCAGAGCCGCAGTGTTTCCAGTGCGCCGGCTGCTCCAAG
TGCCTGATGGGTCAGAGATTCATGGCTCTGCAAGGGAAGC
TGATCTGCTCCGTTGAGTGCAAGAAGAAGATCTCAGCCTC
CTGAAGTCTACTTTTTTTGGGAAAGTCCACCTCAAGCCAG
TATCTAATGCAGTCAATACTGCTAACTTTTTATCAAGTAA
TTAATGAATTAGTTTGACCAATATACATTTTCATGTTATT
CCAAGTAATCATTCATGATCTATAGTGTTAGCATCTTTAA
TAATAATAATAATTTTGTATTAATAAAAGGAAGCAATAGT
ATTTATTTGGGCTACTGAAAAAAACAATATTACATTTTCC
ATTTTTAGGTCTAAAATTGCACTTTATAGTTGTTTTCGTG
CCTGTCATTTTGTAATCCAATAAATGTTTTGCAGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations