Transcript

tesca-201

ID
ZDB-TSCRIPT-090929-18975
Name
tesca-201
Previous Names
  • tesc-001
  • tesca-001
  • zgc:77495-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038607 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038607|OTTDARG00000028383|ZDB-GENE-040426-2632 tesca|OTTDARP00000030933 CH211-42A13.1-001 LG_ CT583689.6 Danio rerio protein_coding KNOWN, 2298 bp
GCATATTTAATGAGTGGGCGGAGCTTCACTGGAAAAGTCT
GAGCGCACGTTGACAAAGTTTAGTTTCAGATCGTTTTCTT
CTTCACACGGCGGTGTTTCTTCTCTCTTCCGGAATTTAAC
ATGGGAGCTGCCCAGTCAGGAGGACAAGCTCAGAAGTACC
AAGATCTGGCTGATAAAACCGGCTTTTCTACAGAGCAGAT
CAGAAAACTCCACAGCAGATTCCAGTACCTAACTCAAGAT
GAAGACACTTTAAGACGTGAACATCTTGAGAATCTCACTA
ATCTGGCCCTCAATCCAATCAAGAGGCAGATCATCGAGGC
CTTCTTTGACAAAAGGAATTTGGGTCAGAATGAGAAGGGC
TGCCTGCAGGAGATTGGTTTTGAAGAGTTTGTCACAGTCC
TGTCTGTCTTCAGACCAACTAAACCACGCACGGCTGAGGA
CAAAAAGAAAACCATCAAGGAGGAGAAACTTCGCTTTCTG
TTCAACATGCACGACACTGACAATGACGGCGTCATCACAC
TGGACGAATACAGACGCGTGGTGGAGGAGCTTCTGTCCAG
CTATGAAACCATTGAAGCAGAAACGGCCAAAGCTATTTCA
GACGCTGCAATGCTGGAGGTGGCCAGTGTCACAGTGGGTC
GGATGAGTCCCGATGAATTTTATGAAGGAATCACCTTTGA
ACAGTTTATGCAGATATTAAAAGACATCGAGATCGAGACC
AAGATGAACGTTCACTTTTGGAACTTGGACACCAGAACGA
TGCATTGTGGGAAATGAAGTTTAACTTCTGCTTTAGAGCA
GCATTTCTCCCATGGATTCAAGTATTGATTTTCGCTGCCA
TATCTTCAGTGCTAAACATAGTGAGCGTGACATTCACTGG
GAAATGCATTTATAGTCCAGACCTCGGGGACAAATGAAAC
ATACTTTAGAGACTTTATACTGTGTATTTGAAGGAGATGT
ATATACCCAGATAAGCCTGGTTATTCTTGAACATGCTTTC
ATGAGTATACAGTATTTTTATTAGGAATTTTATAGTGGAG
GAATTTTCACAAATTAAACAATCTGCGCTTTCTTTGGTTT
GACAAAGCAGTGCTGAAAGACTGACTCCACACCCTGAGTT
AATGAATCCCCAAATCTTATCTTTCACTTCAGAAAAACAG
CAGGGAGAGTCTGTTTTCCTGCTCGTGTCCTCTTATTAGT
AATATGCCATCCTTCTGGCTTCCTTCAATCAAGGTTATTT
ATTAATATACAATGCTGTATATTACATGGTGTGGAGTTTT
TATAGCGATGGCGTATATCAGTCATATTTTTGTACATTGT
TGTCATTTCAAATCCTCAAGTGTAAGCAATCAAGTCCAAA
TCGCTTTCAGATTGGAGAGATTAAATGGTAACAGTTTAAA
TGCGCACTGATTGATCTGTTGTGGATGTATTTCTGTCTGA
CATGATGAATCTTGTGTATGCACGGTTATAAAATACCTCC
CATTCCATATTTGGTTAGGATCTGTGGTTGGAGCTAGAGC
CAAATTAGGAAAATGTCCTGATGGAATGAGTGTGCTTCTT
CTGAGTCTTTTTGAATGCAGCTTCCACATACAGTAGATGA
ATACTTTTACATTTAACAATTCATTTCCGTACATAAGAAA
TTAATAATTAATTGCTTTAATAATCTAGCAATGTGTTAAC
AGTGAGTTAATTAAGCTGATTCATTTAATAAAATAACATG
GGGGGGGTGTTTAAATGGCACCTATTTTACCCCCTCATTC
AAAATTTAAGAGAAGTCTTTTGTGTCTCCAGAATGTGTCT
GTAAAGTTTCAGCTCAAAACACCCATCAGATTATTTATTA
TACCTTTCAGAATCTGGGAAATTTGAGCTGTTTGGACAGT
GTAGTAGTTTTTGTTACCTGCTCTGAAGCGTGAAGGCTTC
AAGTACATAAACAGTACAGTGACACACAAGAATGAAGCAG
ATCTCCCTTACTACAGGAAGAACCCTATTGGTATTTGATG
TAGAGTTAATTCAAGCCTTTCTGCAACGATGAGTCACAAA
CTATGTCATTATAAAGTATGCGCAAACACATACACACGTT
TAGCTTTGCACTGTTTGTGCACGGCATATGTTACAGGATA
CACATTATAATGCCCACTGTATGGATATACGTCAAAATAA
ACCTGATTTAAGGTCCACAAATCGATATTGGAGCGTTTTC
TTTTATTTTAGAAACCTAATACTATAAATATCCCAAACAA
TCAATGACTGAGTTTTGTCTGTTGAATTATTGACAGTAAA
TAAACCAACAAAACTTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations