Community Action Needed: Please respond to the NIH RFI
Transcript

zgc:158852-201

ID
ZDB-TSCRIPT-090929-18892
Name
zgc:158852-201
Previous Names
  • zgc:158852-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038509 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038509|OTTDARG00000028318|ZDB-GENE-070112-972 zgc:158852|OTTDARP00000030857 DKEY-208E17.1-001 LG_ CR382342.5 Danio rerio protein_coding KNOWN, 711 bp
GGCTGACAACCGCCCACGCACATATGACTGGTTGTCAGCC
AATCGGTAAAGTATCATTTCTTCTCGTGCAGCACATAAAT
GAATATTCAATTACAAGCCTTTGGCCTAGTAGAATTCGAG
TGACGCACTTTGCATGTTTGTGGACGGTCCGTGGGTGGGA
ATAAAGTGCGATAAAAGGAACACACTGCACCTGCGAGTGA
TTAATTACATTATCATCACGTCGCTGTAAACAAACAACTA
TGCTAGCACGGTTTGTTCTTGTACTTTGTTTTGCAGCCTT
GGTAAGAGCGGCTGCTATCCCTGATGGCTCGATAGTACCA
AACTGCTCTCAATACTCCTTGCCTATATGTCAACGGGATT
ATAGCCCTGTGTGTGGCACAGATGGATTAACATACTCCAA
TGAGTGCATGCTGTGTATGGAAATTTTTGAGACAAATGTC
AACCTATTAATCTCCAAAATGGATACATGCTGAGCCAGAT
CCACTCGTTTTATTTGGACTGTGACATGAAGGCTGGAACC
ACGTGTTGCTTTTTAATTTTTTTTTTAGTTTTAGAATGAA
GATTTTGTTCTATATTTTTTATATATTCTAATCTTTAAAT
AAAACTTTGATACAAGTCTATGTGTGGGATTTTTTTTTCC
AGTTTTTCCCTTCTCCATGATTGTAGCACCTTTTGATGGC
TCCTACCTGTTGGACTATTGATAAAAATAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations