Transcript

grasp-201

ID
ZDB-TSCRIPT-090929-18825
Name
grasp-201
Previous Names
  • grasp-001
  • graspl-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038442 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038442|OTTDARG00000028273|ZDB-GENE-060312-30 grasp|OTTDARP00000030808 graspl-001 LG_ CU041363.4 Danio rerio protein_coding KNOWN, 2429 bp
TTTTCTGAACGCAGCGAGTGTGTTCGCAGATGCTGCTGAG
GCTGGAGACTGTTGCACAAGTCAAAAAGTGTAGGCTGCTT
GCAAGTGGGTGAGGTGTCTTTTCACCCACACTCAGTACCA
TTCATCTCTTGCTCTTCATTCTTCTGTTCTGTCTAACTGA
GTGACACGCGGACTATGAAAAATATGACTTTCCGTCGCGT
AAAGAAGCTGAATTCAAGCGATCCGGACAGCGGGTCGTTG
TGTCACGACAGTGGAGATATTTACTTCACGTCCTCTAAAT
CGGACAGCTGTGGGATTGTGAATCGTGGACCCTCAAACTC
CACCGAGGTTTACAATTATAAAACCCTTGCTTACTCAGGA
GGAACCCTACCGAGGAACTTCAAAAAGAACGGTGGGCTGC
AGAAATGGAAGCCCCTCGCGCAGTCTCCAGAACCGCAAAG
AAAAACTGTGATCCTGGAGAAGAAAGAAGAGGAGTCCTTT
GGCTTCGAGATCCAGACATACGGGCTTCATCACCAAAGTG
AGAACTCCGTGGAGATGTGCACCTTTGTTTGCAAAGTCCA
CGAAGACAGTCCCGCTCTACTCGCAGGCCTTAAAGTTGGT
GACACGATTGCCAGCGTGAACGACACTTCAGTTGACGGAT
TTCGCCATAAAGAAATCGTCCAGCTCATTAAATCATCAGG
AAACAACATTAGGCTAGAAACCGTCTACAGCGACTCTATA
AGAAAAGCAGAACTGGAAGCTCGTCTGCAGTATCTAAAGC
AAACCCTGCATGAGAAATGGGATGAGTACAGGTCTCTGAT
GGTACAAGAGCAGCGGCTCGTGCATGGTATCGTGATGAGT
GATGTGGCGATGTACGAGTCTCTGGAATCAGCTGGTGTTT
ATGGGAGTCTGGGAGCTCCGAGTCCTGCAGCGTTGCGAGC
GTTACGGGGCACCGACAGCACCAGCAGCAGCGTCAGCCAT
CTGAGCGCCGCCACGGCTGAAGACGACCCGCTCTACCAGA
CCTGCATCTTCAACAACACCAGCAATGACCAGATCCATGC
TAAACAGGAGAACACTCGCCCACGTCTCATTCGACCCGCC
AGCGAGCTCTTCACCACTGCTAAAACCAGCCTGACCCGCA
GTGCCAGCACACGCAGCTACTTGAGGCCTCCATCATCATC
ATCATCAGCATCATCATCAGCAGTGCCAAACGGAGAAAAA
CAGCAGTGCGGAGGCTTCAGCAGCCTGCAGCGCAAACCAA
AACAGAAGAGCTTCAGGCGGAGGCTGCTCAAGTACATCCC
CGGACTCAACAGACCTCTGGAGGAGGAGGAAAGCAAACTG
TGAGACACGAGAAATGCATCCAAAGACAGACCAAAACTGG
AGGAGAAACCAAAGAACAGTTGACTGACTGATTGAGAGCC
AGAGAATGCTAGTCATTTAGCTCTTCTGAAAACGAATGCT
TTGTTACTTTACTCACCCTCAGGGTCTTCTAGGAGGCTTC
AGTGGAATATTAAAGAAGAGTTTTAATCTTTTAGACAATG
GCTACCTGCACTTTAAGAGTCTTCAGACCATCTTAAATGC
ACTGAGGACTGTTTGCTTAGTGGAATAAAGGTAATAACGT
ATATCTTTTGTTCTTGCACAAACCAATCACTTTGCTGCAA
AATATCTGTCTATCATTAATCATGGGGGTTAATTTTGTTG
GTTTGTTGGTTTGTTTTTGACTCCAAAAGTGCAAGTATTT
CCTGAATGATCAAACGAGCGCAGTTTCAGCCGAGCGTTTG
CTTTAATATTCCACTGAATTAAACTATAATGATGTCCTGA
TGGGGAGTAAACTAACATAACCATCCCTTTAACCATCCCT
TTAAGTTTGGCATTTCATCGCCTTTGCTTTTGAGTCTGAT
TACAAGATGCAGACAAACACTGTTCAGGCATAAACTTTCA
TTTTTAGACTTGAAATATTCAGGTTTGTCTAAAATGCTGA
AAGTAAATGTGGATGTGTTTCTGCTGGAATATTGTTTAAA
ATAAATCAGTAATCCATAATATAACAGCTAACAAGACTAT
ATATGGCGGGAAAAAATAGACTCTAACAACAATAGCCAGC
GTGTCTTAATCACTTTGTCAGCTACTTGTTAACATTCTCT
AACTTGCCTTCATGGTTTGATTTTTGCATCTAAACCAAGA
GGTGATGTGTTGTACATATTTTGTTGATGTTTAAGTTATT
TATTTAATGTTTATTTTCAGCTTTTGTGAATTAGTTTTGT
TATTTGAAGATGTACAAAATGAAGGATTGTTTGTTGTTTT
TGTTAAATTGCTACTTGTTCATTTCTATTTGAAAATACTC
CGGTCCTGAAGGATATTTAATAAGTGCCTTGTTGGCATGT
ATGTGTAAATAACTTCTGTTTTTTCTATATTTTTTAAAAA
TTCAGATTGAAAATAAAAGGTTGATAATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations