header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1881
Transcript Name: si:dkey-121a11.3-201
Previous Names: ottdart00000010977, si:dkey-121a11.3-001, si:dkey-121a11.3-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000010977 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000010977|OTTDARG00000009563|ZDB-GENE-050208-417 si:dkey-121a11.3|OTTDARP00000047641 DKEY-121A11.3-001 LG_ BX465190.4 Danio rerio protein_coding NOVEL, 5608 bp
GCACAGTACTAGAGAACTAGTGAACTCAAAACTGAGTCCC
TGCACACTTCATCTTGCTCTCGAGGAAGTATACAGTAAAT
ACATTTGCTCATCTGAAAACTGATTTTTGTATGGATATTA
TGATGGTCGGCTGTGCACATGACTGCAGTCACTGACAGTT
AATGCGTCCTTGGACCCAACCGTGCATGAAGTTCAAGACC
CAACCCAGTGCTCTCTATTACATCTGGCTCTGCTTCAGAA
CTGGCCCCAGAACAGAACAAATAAACACGTATGAAGTCTG
ACTGACTACAAAATGGTGTCTACATGTTTTAAAAAAACAA
AATCAAACTCGAGAGATGTCTAGCTTATTAAACCCTAAAA
CGTGCAGGAATCAGCACAATCAACAAAGGAAATTCCTTGG
CAGCGGGAATATGTGTCTGGAGACTCGCGAGCTTCCTCTC
CTCAGTGTTTAAAAACTCCTTTCCTCCCAAATTCAAGGGT
AGGATTACAACTACTTGCACTCGCGGGCGGAGCTAACGCG
CCTCTCCACCAATAGGAGCGCTCGACAGGTCAGTTCGTCT
CCAAGGTGGTCACGACTGTCTTCATAGCAACGTCGCTATC
TTTCCACATGTACAATCCAGTTTAACAGCTGGAGGAGTGT
GCGAGAGCCAGTATGTTTTAAATGCAGATGTTTAGTGGGC
CAAATTTGAAGTGGGAGTGTGCTGTTTGTACGTTTGAGTG
GGCCAAAACAGCTGGAGAGAGAGAGGGAGAGGGAGAGGGA
AGATTTGGGACTCGCAAAACTGAAAGCAGAATCTAGAGCA
AAATGGGATTTGACTGGCTGTTTTTGCTGACTCCTTGTAA
CCGAGTATTATTATTTTTACAACAATAAAAGTAAATCTAA
GAGCTAATGTGGATGTTGTGGAGGATAGACAGCAGAAGGA
CGAAGGAGCCACCATAATGTTCAACTGACTCCCTGATTCA
ACCATGGAGGACGCAGTGCCCTCTGAGGATGCTGAACCTC
TGACTGCATCCTCCAAAAACACAGACATCCATGATGCGGA
GCCAGAGGATGGGCGTCCTTCCAGCACTAGCCCGGAGCCT
GGCTCCACATCCTTTCCCTCTAATCAGCAAACTCATGGCT
CTGCCGTATCAGCCCTGCAGTCCAAAGTCAAGGCCCTCTC
AGAGCGCAAAGTTGTCTGGAAAGAACCTGGAAGCAAGAAC
CAGGACAAGTGGGTGGTTCCTGGGACCTTCAGGCTGGGAT
ACGCCCTCACAGATGCTTGGGGCTCCAGCAGCAGCGATGA
AGACGGTGAACCTCGCAAACCCTTGATGTTCCTCACCCGA
GACTCCAATCCAGAACTTGAATATGATCCCATCTCTTCTG
AAGCCTTCCTGGCAGTTCCCCGTGGCCTTGGAGAAGGAGC
GAGTCTGGAGAACCTCTCGAATGATGCTTGCGGAGCACAA
GATGACTCTTCAACATCCCATAAACCTTGGATGCCACCAA
AGTATTTCTGGAGGTCCATTAGACAAGAGAAGTCGGTTCC
AAATGGAGATGTTCCGGTGGGGAAAGATGGAGGAAGCTTA
CCTTGGGCTGGTGGAGCCAAAATGCAAAAGTTTCCAAGGG
AACTTCAAAGGTCTGACAGTCTGGAGAGTCACCTGCGCAA
GTACAATCATGGTGAGGTGGGACAGAGTGGACTGTGGAGA
GCCGACAGCTTGGAGAGCATGTGCAGCAATGGAAGCTCCC
TGTCTCTGGCCGAGAGAGTCGAGATGAACCGTGGACTTCT
TAAACAGATGCTGCAGAAAGCCCAGAACAAAGATCACATA
CCAGGACAGAGGCTCGAGGACCAGGCACACATTAATGGTA
AAGGGATCAGTGGCTTGAATGACAGTGATTGGGATTCTGG
GATATCGTTGCAAGGTAGTGAACACAGCCAAAGGGCCTTT
GTGTTGGGCGACGACCTTCCGCTGAGCCCTCGCCACGAGC
AGGCCAAACGACTGCTGGAGAGAGCGCGTATGAAGGCCCG
GTCCAACCCTCTCAAAGCCGACCACACCATCCTACCCGTC
CAGAGGGACAACCCGGAGTTGCTCTCCTGGGTTGGTGTAC
CCCTACACCAGGCTCCTCTTGCGGGGAAGGAGGGCGTGGC
GGTTGTCTCGGGAAACCTCAGTGACTCCTCCAGTGGAGAC
TCAGCTGGCGGGACCCGCCGGAGACACGGGCAGTCTCCAA
CTCGTGTGCGTTTTGAAGATGAATCAGAGAAGGATGCAGA
GGTGCGCTACCTAGAGAGGCTACGCCAAAGACGCAGGGCT
GGAGAAAGAGCGCAGGGCTTGTTGGTATCAAAACCCACCT
TGTCTTCTTACATCAATGGAAAGGCAGAGACTGGACATGG
GTCACATGAGTCAATATTTTGGAAGACAAAAGCCAAGAAG
AGTTTGTTAAATGGCAAAAGTCCTGAGGCACTAAACAGGT
CATGCAACTCTTGTGGGATCTTTTTAAATGAACCTCAAGG
ACCTAGCTTGAACTCAAATACTCTGTCCTTACCTAATGGG
GAAGTTGAAGGGAAGAAGATACCATGTTGGGTTGCTCCCA
CCCTTCCCAACCGGCTTGTCCGGATTGAACAGATTAAGGA
AACATACATTGGGACAAGTCCCGCTATTGTGCACAGCGAT
GGAACACACTGCAGCCCTTCGGATAACAGTAATGGTAGAG
GAACATTTCAGAAGCTAAAGAAGAAGGTTCGAAAATTTGA
CAGCAAGCGGGAATCTTTGTATGTAAATGGCCTCAGGACT
CCATCACCTCTGGACTGCAACAAACTTGCAACACCCAACG
GAACTCAAATGTATCTCTTGAATGGAGTAGCATTGCCACT
CAATCCCTATGCCCCAGATACACTTGGACAGAGAATCCCG
GCCACATCCAGCAAAGGTCCCGTGGCACCTCCATTACCCC
CCAAAGCAGAGCCACCCAGTTCTCAGCCAGCCCAGCCAAC
CCCTCCACCTCTACAACCCAAAAAATCAGCCCTGAAATCC
AGCTCCAAGAATCGCACTAATGATCCGCGGACTGTCACAA
TTATGCCTTCGTCAGAGTACCACATGGTTCATCTGGACTC
CACAGACGCTGGGGGCACTGTGGACAATTGTCCTCAGGAG
CAGACTCCCCCTGTTTTGGGTTACTGGGAGGACAGATCTG
TAATGGTCACCCCTGGAGCCTTACTCAGGACGAGCCCAGT
TCTGTGTGCTCGAAATTTTCCTGTACAAGGGGAAGAAAGG
TCAACAGATGTGGAACAGCACCAGGTAACAGGACAGCTAG
CATCTGATGCAACATCCAGCAGTGCTGAATCACCCCAGTC
TCGTCTCAATGACGGACACGTCCGAGGGCCAATCAGACCA
GTACATAACAGGGCAACAAGCCCAAACTTTTCACAAGCGG
TAACAGATGCTGATCAACGGGAAGGTCGACCCAAGCTCTC
CCTGCGGAGGTTTTTCTCTGCCATGGGGCTGAACAGTGTG
GGGTTGCTGGGAAAGGGTCGATCCAGCAGCATGGATCAGC
TTAGCCTGCACCCCAAACCCAACTCAAACCTAAACCAAAA
CTCCAGGCCCACGTCGCCCTCGCCCTCCCCCAGCCCCACA
CACAGACACCACCACCAGCTGAAGAAAGCCCCGTCACTGC
AGACGATACGACTGGGGTCTCCATTTCTCCAGCTGAGGAG
ATCTTCCTCTGCTCAAAACCTCCAAATCCCTAGGAAAAAA
ACGGATCGCTCTTCTGCATACACTCCAGGAGAACAACCTT
GTAGTCCTGTATTAACCAGGGATCTTCAGCGTGCCTTGAG
TGTGGAGGATGTGGGACGTCCCAGTGCGGTTCGGCCGGTG
GGACGTGTGGCTCAGGCTTTCCCTGATGGCACCATCCTGC
TGGAGCTCTCCAGACCCCCGAACGGACCCTTCGGCTTTCT
CATTTCAAGAGGAAAAGGCAGGCCAGACTCAGGGGTGTAT
GTTGAAGAAATGGGCGACAGCAATATGGAGAAACTGTACG
CGGGGCTGCTGGGGGTCGGGGACGAGATTTTAGAGGTGAA
CGGCGAGAAGGTGGCGGGACTCAGTCTGGACCTGGTGACC
CGTTTAATGACTCAAAACAGCACCGCTTCCATCCGTGTGC
TACGACACAGACGTCTGCAACGCTAACTGAAGACCAGATG
TTTCACTGCACTCAATGTAATCAAAAGAAGGTCAGATGAG
TTTTTGTGAAAGGCAGTATTACTTTTTACCGCCCTTTAGA
GCTGTGTTATGGGGACATATTACACAAAAAAATCATGGTT
TTATTTCATTCATATTGTTCTGGTATTTTTTTTGGACTAA
CTCAAACACTGAATCAGTGTTTGGGGTGTGTTTACACCAA
GGATGATAACTATATGAGTTACCGCACTTTTTGCACACTT
AAGATCCTTTAAAAATGCGAAGTTTGCATAAAAATTATTA
TTTTTAAAAATGTTATGCTATTCATTTAATTCCAGTCACA
TTGAATGTTTTACATAACTCCTGACTCCTCATTTAGAGGA
GATCTGTGATATGAAGGATACAATTTATATTGATTTACAG
CATTATTTTTATTTTTTTGTTTGCGTAATGATGCACAACA
GTCTACGACATAGGTCTCAAACTCGATTCCTGGAGAGCCA
CAGCTCTGCAGTTTGCTCCAACCCTAATCAAACACAGCTG
ATCCAACTAATCAAGGTGTTCAAGACTACTAGAGACTATT
AAGCAGGTGTGAGTTTGAGGTGGTTGGAGCTAAACTATAC
AGAGCTGTGGCTCTCTATGAATTGAGTTTGAGACCATTCA
ATATAGAGTAAAAAAGTAAAAATGTTCAGAGCTTATCATT
ATTAATGACATCATTTTTATGATGGTTTGATATAACATAG
TTTATCATATCAGCCGTAGCTATAACCATAATCTGCCATT
TGGAGCATTTTGCACGATGGTCCGTGTTACAATTTTCACT
TCGTTTTCATTCATTAGTGTTGAAGCTAATATATTTATCA
TTCTTGTTGTGGCCTTTATGTTTAATTTACAGTCGTACAT
TGAAAAACAAACAACAACAAAAACCTGATTTAGTCACATT
TATTTAGTGTTTTCTGACCAGAATTCTATACTATTAAATT
ATATTGTTACAAAAGAATATGACACATAACTACGTATGAA
GGACAAGAATATTTCATGCACCAAAAGCTAAACTCAAGTA
TTATCATAATGAAGCAGGATTTTTAACTTCTTCAGAACAT
TCAGTTTCATTCAAAGACTTTTCACAGTGGGTTCTAGTAC
CTTCTCTATGCTGCTGACGAGTACACAGATCTATACTGTA
CACGATCAAAAGAGCTTCATATACTCCTCCTAGAGCGCGC
ACCGGCTCAGTGCGCACGCTGCATTGCATTGATCATCCGC
TTGAAAAGCTCTTTAGTATATTGATTGGATATTTCTCCAT
GAGCCAGCACATTGCCATGCCTCTACAGTGAAATCCCACA
CCATTAGCGTGCTGCCCTAAAGGAGATCAGTATTACGGTA
CATGCTACGCAAAAGGCTACCAGTCTAATGTATTTTGTTA
CATTTATTTATATGTGTTCCTATCAAATAAAACAACTGGC
TTTTGTGG

si:dkey-121a11.3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-121a11.3-201 5608
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-121a11.3-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000010977 (1),  Ensembl_Trans:ENSDART00000142454 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DT876325 (1) 724 bp
GenBank:EE213937 (1) 593 bp
GenBank:EE213936 (1) 523 bp
GenBank:EE211916 (1) 460 bp
GenBank:AW422180 (1) 449 bp
CITATIONS (2)