Transcript

or133-1-201

ID
ZDB-TSCRIPT-090929-18790
Name
or133-1-201
Previous Names
  • or133-1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038407 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038407|OTTDARG00000028252|ZDB-GENE-070806-34 or133-1|OTTDARP00000030778 or133-1-001 LG_ AL929321.12 Danio rerio protein_coding KNOWN, 963 bp
ATGTCTAATTCCAATGTTACCAATTCGAACATCACTCAGA
CTATAACGCCAGTGGATCGAGATCTGAAAACCATTTTATC
CGTGTCCTCGTGTGTTATTTTCCTCTATGTCAATGGAGTC
ATGATCTTCACCTTAAGGAAAAAGCCTGTTTTTCAGGAGA
CGTCTCGCTATATTCTGTTCGGTCACATGCTTTGGGTCGA
CACGCTTAATCTTGTAATGAGCGTAGTGTTATTTGCTTGT
GCTGTTTTTAGGCCTTTTGTTATGAAAATTGTCTGTCTTA
TACTTCTTGTTGCTGCGACAGCTCTCTATCAGGTCTCAAC
TTTGAATCTGGCTTTAATGTCATTGGAGAGATATGTGGCC
ATCTGCTTTCCTCTCAGACATGCAGAAATCACCACTTATG
GAAGAACCAACATGGCTATTGGTGTTATCTGGATGATAAG
CTGGATTCAATCCCTGTCTGAGATTGTTATCTTTTATTCC
ATTGATACAACCAACATAGCAGTGAATTTGTTCTGCTCTA
GAACTACTCTCTTCAGACTGCAGATTTATAAGAATCTTGA
TGTAGCTTTCACATGTGTATATTTTGTGTCTGTGTGTTTT
ATTATCATCTTTACTTATGCCTCTATAGCAGCTGTGGCTA
AAACTGCCTCCGGTGATAAAGCATCAGCCAAAAAAGCCAC
CAAGACTGTCCTTCTGCATCTAATACAGCTGGGTCTATGT
GCTGCATCTATTTTAATTGGAGTAATTCAAGAAGTCATTT
ATGTTTTTACCAGCTATGCGACTATAATTAGTTTTATGTT
TTTCTTCTTTGTTGTGTTTATGATTTTTCCAAGATGTCTA
AGTCCTCTTATTTATGGTCTGAGAGATCAGGCCTTCAGCA
GTTTATTTAAATACTACTTCGCATTTGGTCTCAAAAAGCC
AAGCAAATGTAATACAGAGATGCATTTAGGAGGAGGCAGC
TGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations