ZFIN ID: ZDB-TSCRIPT-090929-18765
Transcript Name: stk35-201
Previous Name: stk35-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038382 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038382|OTTDARG00000028237|ZDB-GENE-061103-553 stk35|OTTDARP00000030756 stk35-001 LG_ CU914487.7 Danio rerio protein_coding KNOWN, 1935 bp
ATTGTTTATGTCAGTCAGACGATTGATGGAGGAAGTGACA
AAAAACACCAAAACAAACTAATCGATTTGACTTTCCGCAA
CTCTCATTCAGAGACGTTATGAAAAACAGGATTATTGCCC
CGAAACATATGCTGTCAACGCAAGGGGTAATAATAAACTC
ATGGAGCTGCGGAGAGTAACGAGCCTCCGGCGGGGCTGCA
AAAGAGCCAAGCCGCCCAGCGCGATCATGTGGCGGGATAG
TAAAGTTCTGCGCCCGCTGCCCGTGGAGACCAATAATGAT
GAGGAACCCATGGAGGAAGACGACTTTTTCTCCTTGGGGT
TCCTCAAGAAGGACAATTTCGAGGCTGGGATAGTCTTCAC
AGCGCCTCGGTATAGTTTAATTCGGGAAGTGGGTCGCGGG
AGCTACGGCGTGGTTTACGAGGCCGTCGCCCGGAGGTCTG
GAGCTCGTGTGGCGATTAAAAAACTCCGTTGCGACGCGCC
TGAAAAAGTGGAGCTGGCGCTGGCTGAGTTCTGGGCCCTG
GCGAGCCTGGAGAAAAGGCACGAAAATGTGGTGCAACTGG
AGGAGTGTGTCCTGCAGAGAAACGGGATGGCACAGAAGAT
GAGCCACGGGAACAAACGAAACAAGCAGTATTTGAGATTA
GTGGAAACGTCGTTGAAAGGTGAGCGTATCCTGGGTTACC
CAGAGGAACCTTGTTATCTTTGGTTTGTTATGGAGTTCTG
CGATGGCGGTGACCTTAATCAGTACATCCTCTCACGACGG
CCCGATCCACGGACCAACCGAAGCTTCATGAAACAATTAA
CCAGTGCTGTGGCCTTCCTCCATAAAAACAACATCGTCCA
CCGGGACCTCAAACCAGACAACATTCTCATCTCGCAGAAA
TCCGGCAATCCTGTCATCAAGGTTGCAGACTTTGGTCTCA
GCAAGGTGTGCGCGGGACTCAGCTGCATGCAAAACGAAGG
CGACGATCAGGTTAATAATAAGAACATAGTGAACATTAAT
AAGTTCTGGTTATCATCAGCATGCGGATCTGACTTTTACA
TGGCACCCGAGGTGTGGGAAGGCCATTACACGGCCAAAGC
GGACATTTTTGCGCTAGGCATCATCATTTGGGCTATGATT
GAACGGATCACGTTTATTGATGCCGAGTCTAAGCGAGAGC
TTCTCGGGACGTATGTTCGCCAGGGAACTGAGATCGTCCC
GGTGGGTGAAGCCTTGCTGGAGAATCCCAAAATGGTTTTA
CACATCCCGCAGAAAACACGGAGCATCATGTCGGAGGGCG
TCAAGAGGCTTCTGCAGGACATGCTTGCGGTTAATCCACA
GGACCGGCCAGATGCATTTCAGCTGGAGGTCAGAATGGAC
CAGGTCACATGTGCGGCGTAAGAGGACCCGATTGGCCAAA
ACAAGCATGCAACTTTTTCAGGTTTTCACAGTAAGACAGA
AGTGAAAAAGGGAAAAAGCCAATCCTGGAACTGTGAATTG
ACTTTTGCGAACACTTGCAAGAAGCAGAAGTGAAATTAAA
GAGATTTCCTGTCTATTTTAAAGACCCATCAGATGGAAAT
GCTATGCAGGTATCATCATCAACACCCCCAAAACTCATCA
CAACATCTAATTCCAGATCTCACCAGCAATCCAGTCATAT
TCCTGCTGTTGTTTTAGACCAGATGTTGCACTTTGTCTGT
ACCTCTGTCAAAACTACCTACCACTTACCACACAGTATAC
ATGTGAATAGCTAGATGTCGATAATAGGGTCGAGCGAATG
TCTGCGAATGCTCTTAAATATGCACCAGACGACAGAGAAG
GAAGTTATTCTGAAGCTCACGAGCACGAAGACACACTGTG
AACGATATAATGTGAATTTATGCGTGCAAAGTTACACCGT
TTCTCCTTTAGGTCACGTTAAATACAGCATTTCTTCCCAA
AAAAAAAAAAAAAAA

stk35 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript stk35-202 (1)    Ensembl 733
mRNA stk35-201 1935
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
stk35-201 Contained in:
[BAC] CH73-189P6 (1), CH73-302A13 (1)

Genome Resources: Vega_Trans:OTTDART00000038382 (1),  Ensembl_Trans:ENSDART00000128302 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC125863 (1) 1939 nt
GenBank:EH454061 (1) 886 nt
CITATIONS (2)