header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18660
Transcript Name: aqp7-201
Previous Names: aqp7-001, zgc:63700-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038270 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038270|OTTDARG00000028181|ZDB-GENE-030131-6461 aqp7|OTTDARP00000030669 CH211-260M19.5-001 LG_ CT027620.13 Danio rerio protein_coding KNOWN, 2461 bp
TTCAATTCACACCAGTGCAACTATTCAAAGAGTCTGAATG
ATCAAGCTGGGAGAGAAGAGTCTAGTGCAGAAAAGGAAGT
GAAACAGGAAGTCAGCATAATGGAAGATGGCAGCATTCAA
GGCCGCATGGCTCCAAATGTTGGATCCATGTTGAAGATCA
AGAATGAATACATTCGAGTGGCTTTGGCAGAAAGCCTCTG
CACATTCATCATGATGGTGTTTGGCCTTGGCACTGTTGCA
CAAGTGGTTACAGGAGAAGGTTATTTTGGTGAATATCTCA
GCATTAATATAGGCTTTGGGCTGGCAGTGGCTATGGGTGT
GCATGTTGGTGGAAAAGTGTCAGGAGCTCATATGAACGCA
GCTGTTTCATTCACAATGTGCGTGTTTGGCCGATTGCGCT
GGAAGATGCTGCCGCTGTATGTTTTCGCTCAGTTTCTGGG
TTCATTCCTTGCCGCCGGGACCATTTTTTCACTTTATTAT
GATGCCATAAATCATTTCTGCGGGGGTAATTTGACTGTGT
CCGGACCCAAAGCAACAGCTGGGATCTTCGCCACATATCC
AGCACCCTATATCTCAGTCTACACTGGATTCTTTGATCAG
GTTGCTGGCACGGGCCTGCTGTTGTTGTGTCTGATGGCTC
TGTCAGACCAAAGGAACCAGCCGCTGGTGTCTGGAGGTGA
AGCCGTCGGTGTGGGGCTTCTAGTGATGCTCATCGGCGTC
TCTATGGGGAGCAACAGCGGTTACGCCATCAATCCCACAC
GGGACCTGGGGCCACGGCTCTTCACACTCATGGCAGGATG
GGGCACAGAGGTTTTCAGGGCAGGCAATTGCTGGTGGTGG
GTACCCTTGGTGGCTCCTTTTATTGGAGGAGTTTTAGGGG
CTTTAATCTACAAAGCACTTGTAGAACTACACCACCCTGA
TCTTAAAAGCACTATAACACGGCCAGCAGTAGATCCTGAA
TGCATTCCTCTGGACAAGTGCAAGAACGGCAGAATTGAGA
TACCTGTGTGAGTCCATTACCAGGTAAAAACCCAAATAAA
TGAAGGAAGCAATGAAGTAAAGTGACATTTCCACTGGGAA
AAGCTGGAATATTCGCAAGCAACAAAACATGTTGTCGAGT
TGTGCATTTCACAGTTGTGGATGTTGAACAGGGGTGTCCA
AACACAGTCCTTGAGAGCTGGTGCATAGTTTAACTTCAAC
TTTCTTCAACACACCTGCCTGAAAGTTTCTACTATACCTA
GAAAGAGCTTGATTAACTGGTTCAGGTGTGTCTATTTGGG
GTTGGAACTAAACTTTGCAGGGCCTTGACCCTTCAGGGCC
AAGATTGGGCATTCCTGATGTCGAAAAAGACTAGAAAAAC
AACTGTGGTCCACATCCTATACTTATAAATAGGGAAAAAG
TGCAATACACTCGCTCTAGAGAAGGAAGTCCTGTCTTCCC
ACCAGAATAACCTGCACTCAATTTACTTTTGCTGCTTGTT
CAAACTGCTTATTTAATGAGTTGAACCAACCTTAAGTTTT
TGGGAGATGACTTAATTTTATGTTTTATCCACTTAATTTG
TAAAAACGATGAAGTTAACCAATTTGTGTTGGGACAACAT
GAAGGAATTGTGTAGAACCCAACATTTTTTTACAGTGTAC
ATCATTTTGAGGGATGTAAACAATAGCAATGGTGCTAACG
TAATTCCTGTACTGGATTTGTAATTTCTTTAGCTTCAGGG
AAATTAAAAAAGCTCCACATATTGATAAATAACCCTATGG
CAGGTGTTTTAACATGAAGTTATCATTGATCTGCCTCTTG
TTACGAAATAGTTTGACAACAAGCAGGAAATGTTCAATGG
GCCAATGACATCACATTGAAATGCTCTAGTTAATCTTTAC
AGACGGGTGAATCTTCAGCAGAGGAGCTGAACAAACTCTG
TCATTTTACTACTGTGTGCCTGTGCTGCATCTGAAAGCAG
AAATGCCAGAGAGACTTAAACACAACATCCTATCACACAT
CGTGTCTTTCCAAAGATGTCCACCAGTCTGTCCTCCAGCT
TCTGCTTCTTTTGTGCTAGCCTTTGTATAGGCAACTGCTG
AAAAGGCCAAAAAGGAGCTTAGTGTTGTGAAAGACAATAT
TATTTCATGCATAATCACTGAAAAAATTATAATTGGAGCA
TTAGCAACAAAAGTAATGTGACCAGTCACTTGAGATGCTG
TAGCTGGTTTGAGATGTTTGTTTTAACCCTTTTGTATTGT
TCAAATGTACTACCATTTTGGCATGTTCGGGGCTGTTTTT
GCCCCATTGACTTCTTTTTATAACAACAAATTTTTGAATG
CAAAGCCATGACACCAAATAATCATGTGTTCATGGTTGTC
TGTGTTTTTTCCTGTTGGTAAGAGGTAGAACTTTTTTTTT
TTTTTTACTGTCGATTATCAGTTGGCACTAATAAACCTTT
AGATAGGCCTGTGCAAATAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aqp7-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000038270 (1),  Ensembl_Trans:ENSDART00000123522 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC056802 (1) 2480 bp
CITATIONS (2)