Transcript

dhrs3a-201

ID
ZDB-TSCRIPT-090929-18647
Name
dhrs3a-201
Previous Names
  • dhrs3a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038257 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038257|OTTDARG00000028173|ZDB-GENE-040801-217 dhrs3a|OTTDARP00000030659 dhrs3-001 LG_ CR548634.10 Danio rerio protein_coding KNOWN, 1723 bp
AAACCATTCTCCTAAAGAGAGAGAGAGAGTGTGTGTGGTT
GAGAGAGAGAGAGGGGGGGAGACGTCTTGTGTGACAGTTG
TTCACTCGCAGATTTTGTAGGTAAGACACTTGGCACACTG
ATGGACCTCTGTTAGACTCTAAACTTCTAGGACGAGGAAA
GCAGGACTCGTTTCCAGTTTCTCCAGCGTGCCTTATGACA
ACTGACAAGTTACACACACTCTCCCTACTCACGAGCTGCT
TTATTCCTCAAACTCGATAGAAAGCCTGAACTGTCTGAAA
ACCATGATGGAGATGAAGGTGTTGGGCTGCGCGTTGCTTT
TCCCCTTCCAGATTGTCTTCAGCATTTTGAAGGCGACCGT
GCGCTTCTTCACGCGCCAGAAGCGCAGAGATCTGGGCACT
GACGTGGTGCTCATCACTGGAGGTGGAAGAGGAATCGGCC
GTCACCTGGCCAAAGAATTTGCCAAGCAAGGAGCGAGAAA
GGTGATTTTGTGGGGCCGCACAGAGAAATGTTTAAAAGAG
ACCTGTGAGGAAATCTCCATGACTGGAACTGAGTGCCATT
ATTTTGTATGTGATGTGGGCAACAGGGAGGAGGTTTACCA
GCAAGCAAAAGTTCTCAGGGAAAAGGTCGGGGATGTCACC
ATTCTTGTAAATAATGCAGCTGTTGTCCATGGGAAAAGTC
TAATGGAAAGTGACGATGATGCACTTTTGAAGACTCAGCA
CATAAACACCCTTGGACAGTTCTGGACCACGAAAGCATTT
CTGCCTCGCATGCTGGAGCTGTGCAACGGCCACGTGGTGT
GCATTAACTCCATTCTCTCCCTCTCCTCTATCCCTGGAGC
CATCGACTATTGCACGTCCAAAGCCTCGTCTTATGCCTTC
ATGGAGAGCTTGACGTTGGGCCTGCTGGACTGTCCTGGAG
TGGGATGCACTACAGTTCTTCCCTTCCATACAGACACAGA
GATGTTCCAGGGCATGAGAGTGAGGTTTCCTAAGCTGTTT
CCTCCTCTGAATCCTGAGATGGTGGCAGAGCGCACTGTGG
ATGCAGTTAGGACCAACACTGCCTTCGTTGTCCTGCCATG
GACCATGCACTTTCTTGTCATTCTTAAGAGCCTTCTGCCC
CAGTCTGCTCTGGAAGAGATCCATAAGTTTTCAGGAAGCT
ACACCTGTATGAACACATTTAAAGGACGGACTTAATCTCA
GGAGCTGCTTGACTGTTGATTTTTAATTCAAAGCAAGTAC
TACGTCCAGGAACATCACTCTGTTTTACTGTGGACACAAA
AAGATGAATATGAAACAGTCATTGGGATGAGCGAATCGAG
ATGGCTTGTTGTCCCAAGAACTGTTATGTCTGCAAGTCTT
ACATGGATGAATTTGGATTTGATTGCCCTATACTGGACTG
CACAAAGACATGTAGAAGAAAATGTTTCTCAAATACTGTG
ATAACAGGGAGCACAGACTGTTGAAAGGAAAATGTTTTTT
TAGAAAGCTCTGAACTTTTCATAAGGGCCCCTAAAAGGCT
GCTCTTAGATTTTATAGTTTTTCACAGATTAAAAAAAAAA
CATTTGTAGCACAGGTCAATGCAATTTGACTTTTCAACTG
TATACAGCAAATATATATATATATATTTAAAAAAAGTTAC
TGATATAGATGTAAAAATGCCCATTGTTTTTCAGTCAAAA
TGTTTTGCATTATTCTAAAATAAAATAAAACTTGTCCACT
TTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations