ZFIN ID: ZDB-TSCRIPT-090929-18533
Transcript Name: ndnl2-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038142 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038142|OTTDARG00000028116|ZDB-GENE-031107-3 ndnl2|OTTDARP00000030575 ndnl2-003 LG_ CR376802.12 Danio rerio protein_coding KNOWN, 870 bp
AGCAGAAGAAAACAACCGGGAAATTGCGTTTTGGCGTTTG
AGCTCGAGTTGTAAATAGTTTTAAACATCAGTGAAAGGTT
GTTTTAATATCATCCGGCATTGTTACCGGTCTTTACATAG
TTTTACAACCGTTGACATTGTATCGTTAGACGCATTGATC
TTGGTAAAATCTTAACGTTTTTTTTATTAATTACTCAGGG
TCCGATAGCCATGTCTCAGAGGAAGAAAGCGACTTCAGCT
TCTCAGAACAAAACTCAGAGACGATCACAGTTATTGCTGG
AGGAAGATGAGGATGCAAACTTCAGCCAAATAACATCATC
ACAGGCTCAGAGAGCTCGAGAGAACTTCACGTCTGACCAG
ATAGACCACAAGGTGGCAGAGGTGGTCCAGTTCATCTTGA
TTAAAGACCAAAAAAAAATCCCCATCCGAAGAGCAGACAT
TGGAAAACATGTGATAAAGGACTACAAACACATCTATGCG
GAAGTCATGAACAGAGTTTGCCGTACATTTGAGCAGGTAT
TTGGATTAAAACTAGTGGAGATTGATCTCAAACAACACAT
TTATATTCTGATCAATAAACTGGAGCCTATTCGTGGACAA
ACAGTGAGCATGCATCCTGGAAACCCAAAGATGGGTCTGC
TGTTTGTCATACTTAGTGTAATTTTTATGAAGGGTGGTAC
CATCAAAGAGAATCTGGTGTGGAATACACTCAAGAAGCTG
CGGTTGGATCCAGGGGAAAAGCATGATGAGTTTGGAGATG
TAAAGAAGGTGGTCACTGAAGAGTTTGTACGGCAGAAATA
TCTGGAGTATGGAAAGATTCCTCACACAGAACCGGTGGAA
TATGAATTCCGCTGGGGTCTGCGGGCAGAG

ndnl2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ndnl2-001 (1) 1084
ndnl2-002 (1) 1580
ndnl2-003 870
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ndnl2-003 Contained in:
OTHER ndnl2-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038142 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH552618 (1) 908bp
    GenBank:EH539595 (1) 848bp
    GenBank:DV589162 (1) 759bp
    GenBank:CT608169 (1) 566bp
    CITATIONS (1)