Transcript

mgat5-201

ID
ZDB-TSCRIPT-090929-1849
Name
mgat5-201
Previous Names
  • mgat5-001
  • zgc:136939-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000010896 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000010896|OTTDARG00000009499|ZDB-GENE-060616-238 mgat5|OTTDARP00000009379 mgat5-001 LG_none BX664720.7,CU861502.15,CU571316.10 Danio rerio protein_coding NOVEL, 5447 bp
GACAGCGAAACGAAACACACCGACTGTTGTCAGGTGCGTG
GATCCACACTGACGCCGATCACAGTGAAACCACCGGCTTT
TCCACAGCATTTAACGTCCATATCATCACCCCAAATCTCA
AATCAGTGTCTTCACTGTAATGGAGCTTCTGGTGGGCATG
TCTCTTGTTTGATTGACATCTCACGCTAAAAGGAATGGAC
TACAGTGAAGAAAAGAGCGCGTAGAGACCACACCCTCAAA
ACACAATGAGGCTGAACTCGTCTTGAGTTGCCCAGACACA
CACTCCACACACTCACACCAACAAACTGTCTCACCATGGG
CTCCGTGTACTTGTGGAAGTTGTCTTCCCAAAAGTTGGGT
TTCTTCCTCGTGAGTTTCGGCTTCATTTGGGGGATGATGC
TGCTTCATTTCACCATCCAGCAGAGGGCGACGCATGAAAG
CAGCGCGCAGCTACGAATGCAGATACTGGACCTTAGCAAG
CGATACATTAAAGCCCTTGCAGAGGAGAACCAAAGCGTGA
TGGATGGACCCTACGTAGGCACCATGACAGCATATGATCT
GAAGAAGACTCTAGCTGTTCTTCTGGACAACATAATGCAG
AGATTGTCCAAGCTGGAGTCTAAAGTGGACAATATCATGT
ACAATGGCACCAGCGCCAACCTGACCAACGGCACCGGGAC
TCCCGGACCAAACCCAGTCAACCCTGAGAAAGTCAACGTG
GCAGATTTGCTAAACGGAGCGCAGGAAAAATGTGAACTGC
CCTCGCTTGACGGGTTTCCACATTGTGAAGGCAAGATAAA
GTGGATGAAGGACATGTGGCGTTCGGACCCCTGCTACGGC
AACTATGGTGTGGATGGGTCCACCTGCTCATTCTTCATTT
ATTTGAGCGAGGTTGAAAACTGGTGCCCTCGTCTGCCGTG
GAGGATTAAGAACATTGGGGATGACTTGGACAGGAAAACA
CAGTTGGAGGTCCGCACAAGTTTTGACGAGTTGTATCGCG
TGATGTCGCGGCGTGAGGAGTTTCGCTGGATGATGCTGCG
GATCAAGCGGATGGAGGAGCCGTGGGTCAGCGCCGTTCGC
TCACTTGCCAACAAACAAAACCTCCACCACCGCAAACGCA
AGAAGATCCTGGTTCACCTGGGCTTGTTGACGAAGGAGTC
TGGTTTTAAGATAGCGGAGAATGCGTTCAGCGGCGGTCCT
CTGGGTGAGCTGGTGCAGTGGAGCGACCTCATCACCACAC
TCTACCTGCTCGGACACGACATCCGAATTTCAGCCTCCCT
CGCTGAGCTCAAAGAGATCATGAAGAAGGTGATGGACAAT
AAATCCAGCTGCCCGACCAAAGGCGATAAAGTGGTGGAGC
TGATTTACATCGACATCGTGGGCCTGGCGCAGTTCAAGAA
GACCCTCGGCCCGTCCTGGGTCCATTATCAGTGTATGCTG
CGTGTGCTGGACTCATTCGGGACGGAGCCGGAGTTCAATC
ACGCTCACTACGCCCAGTCCAAAGGCCACAAGACTCCGTG
GGGCAAGTGGAACTTGAACCCGCAGCAGTTCAACACCATG
TTTCCTCACACTCCCGATAACAGTTTCCTGGGCTTCGTGG
TTGAGCAGCATCTGAACGCCAGTGACGTCAAACACATCGA
CGACATCAAGCGGCAAAACCAATCGCTGGTTTACGGAAAA
GTGGACAACTTCTGGAAGGATAAAAAGAAGTACCTAGACA
TTATTCACTCCTATATGGAAGTTCACGGCACAGTCCATGG
CACTAGTACAGTCCACCTGCCTGGCTACGTGAAGAACCAC
GGCATCCTGAGCGGACGAGACCTGCAGTTCCTGCTGCGAG
AGACCAAGCTTTTTGTTGGCCTGTCGTTTCCCTATGAAGG
CCCCGCCCCTCTCGAGGCGATAGCCAATGGCTGTGCATTC
CTGAACCCGAGGTTTGATCCTGCTAAGAGCAGCAAGAACA
CCGATTTCTTCAAAGGCAAACCCACACTCAGAGAGTTGAC
GTCTCAGCATCCGTATGCTGAGGTTTACATCGGCCGGCCG
CACGTCTGGACCGTTAACATTGAAGATCCGGCCGAGGTGG
AGAACGCCATTAAAGCCATACTGAGCCAGAAGATAGAGCC
GTATCTGCCGTATGAGTTCACCTGTGAAGGGATGCTGCAG
CGGGTCAATGCTTTCATTGAGAACCAGGATTTCTGTCATG
GTCAGGTGATGTGGCCGCCGCTCAGCTCCATGCAGGTCCG
GCTGGCTCCGGCTGGGAAATCCTGCAAGCAGGTGTGTCAA
GAGGAGCAGCTCATCTGCGAGCCTTCATTCTTCCAGCATC
TTAATAAAGACAAGGATCTGGCCAGGTACGGTGTGGAGTG
TAAAACGGTGGACTCAGCCAATGATATTGTAGTCCCGGCG
TTCAGCGAATCGTCCCGGCACTGTGTGTTTCAGTCCGACC
TGCTGCTGTTCAGCTGCGCTGGAGCTCATCAGACCCTCAC
GCGCATCTGTCCCTGCAGAGACTACATGAAAGGCCAGGTG
GCGCTGTGTAAAGACTGCTTATAACACACACACCACACCA
CGCACTTTTCGGCAACTCGTACCAACTACTGGTGGCGTTC
AAAAACGCGCCAAATGGACAATAATAAAGCGTACAGTGCC
AGAGGTGTAATGGTGCGATTAAACGAAACAATGCAGAGTA
ATTGAGCGCTTGTTTTATTCCCATACACACACCAACTCGA
ACGCTGGAGCGCGGCAGCTAAGAAAAAATACAATGGACGT
CGCATAGAGCGAGGAGAATTTTATTATTATTATTTTGCTG
GATTTGTTTTTGTTGTTGTTGCGCAAACCTGAACTAGATT
CAGCCTGACATACTTGAAGCGGTGTGCAGGGGATCAGGAC
TCTACACTGCCACCTGCAGGCTCGGAGGAAACACTGTAGT
GACATTTATTACGCCAGTTCTTCGTTCTGCTGATTTGTTT
TTTTTTTCGTAGCTTTTTGAAGAATGACTTTCTATCATTG
GACCAAGCTTGACACCGGACATCTCGGAGGGATCTTCGCC
CTTTGGAGGATTGTTTTGTTTGTTTGTGTGGCAATGAGTA
TAGTTTTAAAATCATTGGGAAACAAATTCATCGAACGATG
GACTACGAAAATTTTACTTTTTCATAGAAAAAAATCACGT
TTATTTCACGACTAGATGGTCTGGCAAAGAAAAAAACTTC
TTTTTTACATGAAACAAGATTTCGCAACAAAACGGATTTC
GTGCGTTCATGGAAAACAGACATTCCTATGAAAAGGACTT
TACGACAAAATGGACCTCTGAAAGAAACTATTTCACAACG
AAACAAATTTTGTGGACAAACTTTACGAAACGTTTTATTT
TACAATGAAACTGACTTTACGAAGAAAAAGAGTTCAAGAC
GGACTGAAATGAAACAGACCTCCACAGTTGAACTTCATGA
AGAACTAGACTTTACGATGGAACCGAAAAACAAACTTTAT
GAAGAAAACTACTTTTCGAAGAAACTTCTCTGGATTTACT
TCAACACAAGAAAACTGATTTGACGCAAACTTCAGAAGAA
AAATCTTCTCAAAGAAACTTCCCCAGGTTTTTCCTGACAA
CAAAACGGACTTCTCAACGAAACAAAGTTTGCGATTAAAC
GGACATCCCGAAGAAGCTTTCCCGGTTTGACACTGTAACA
AACTTTCCATCAAATGACGCGTTCACTTGTAAATACGACG
CCGAAATTTACAGTCCGCTTTATTCTGCATGGTAGTTTCT
TTCCTGTGATGCAAACGCCAACTTGTAACAGCACATTTTT
TCAGTGTTGGTCACCATCCACACGAAATATCGCAGTACAG
CACCGGTGAACTGCCAGGTTAACATGTTTTAGTGATAAGC
AAAGTCACACACCAGCCAGTATGAATTAAAACACACACAA
ACACTATTGACCAAAATAACCGTTAAAAACTAGTAGATCG
ACAAAAATTGGGATAGTTTTTGCTGGTTGTTTGACATTGT
GTCCCGGTTTACCTAAACTAGCACTCTATCACAGCTTTCA
AACGGGTTTCTATATGTGGATATGGTAAATACCTATACAG
TCACGGATATTTCTGTAAAAAGTAATCATTCTTTGTACAA
AAAAAAATCTATTTAGAGTATATAACTAGGGTAAGTTTTT
TTTATTTGTGTTAAAAACACAAATTGGCCTTCCTTGTTTT
ACTTTTGTTTTGCGATTTACAATGGCCTATATTCTTGAGT
TTGCCTGTCCATTATCGAGAAGAAAAACAAGTCAAAATTA
TTATTAGTTCTTTGTGTTTTGGAATGAACATGCACTATAG
CGGAGATTTGACACCAGATATTACAACACTGTACAACTTT
TTTAAAGTTTGATTTTTAATTTATTTTGTATACAGATCTT
TATCTCTGCCTGTTGATTTTTATGTGACTATTTATAGAAG
AGAATTCTTTATAGAGGAAACTATTATTTATCAAAGTAAT
TTAAGTGTGAGCGCATGTTTGTTCAGAGTAAACAAGATTT
GCGAAAGTTAAAATTGTTTTTATTTGTTTAAAATGTAATT
ATAAACTAGTGTAACATATCATTATAATAATTTCCCTTAT
CGTCAATACTCTGGACAAACATTGCGAACAAAGTTTAATT
TCCGAAGCCAGCAAAAACCTCATTTGATGTTTTTATCCAG
TGTATGATTTCTGTAAACATTTGCACATTTGTAAATATAG
ATGGGTCTCTTCTAGTTTTCCACTGTAACTTATACGGATA
GATTTACGTTTGCGCTTTTCTTTCGTACGTTTGTACGTAA
ACTGATGGTCTTCAGCCAAGCTATCGTTTAAATCTTGTTT
CATGATGTGCCTTCGGATGGTTACTAGAACTATCTGGTTT
GTTTTCCTTTAAGAAATAATAAAAAAACGTTGAAGATGGA
ATGCTAGCTAGCTAAACGCTGAAATAGTATAGCTGAAATA
GTTGCTTGACGTTTAGCGCTAAGTCGTTTTGCCAAACGTT
TGGTGGTTGTTGACACACAAAAATCACAGGAATGTGTGTA
GTTGACTAAAGTTGTTACATTTGGTTTACAGTATAAAGGA
CGCCACCGTTTCGAGAGTGTTTGTACAGCTTAGCTGTAGC
TATAATAATGACTGTCTCAACGTTTTACGATATTAGATTA
GCCTAATAAAACATGTGGCCCGTAATTGGAACAAAGCCCA
AATTATGTATGGAACCATTGTTTATTTGATTGTTTTTAAC
AACTGTTATGGTTTACTTTGCTGTTAATAATGGTTGCTTT
GTTTAATTTTGCATTCGCACAAAGAAGTTGCTATTAAATT
CATTTTGGGGAGGGTTTTCATGGAGAAAACTTTAAGAAAA
GATGAACGGACACAGTTTGTTGATTTTTGAGGAGTCAGTA
GGATATATCTTTATTTTTCAAATAAACTTTTTCTGTGACA
ACAGACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations