Transcript

atp1b4-201

ID
ZDB-TSCRIPT-090929-18334
Name
atp1b4-201
Previous Names
  • atp1b4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037937 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037937|OTTDARG00000028001|ZDB-GENE-070412-1 atp1b4|OTTDARP00000030404 atp1b4-001 LG_ BX004980.8 Danio rerio protein_coding KNOWN, 2484 bp
ATTCACTATGATGCTCGACTCCTAGCGAGAAGCTCCTCCG
CACCCGACATCCGCTGTGAGGGGGAAAATTCAATGAAATT
CACCAACCATTCCTGACCAGAATTAACGTTGATAAATCCA
GCGTGAAGTGAACCCGAAGGCGCAACCATCAAGACATTAT
TTTGGGGGGAAATTTGAGCATTGACATTTTGATTTTTACA
TCATTTTTCTTGACAGAAGACATCGAAATATTGTTTTGTG
ATTTTTTTTATTTTTTAGAAAAAGTCTGAACGATTATTTC
ACAAAGTGTTGACTCTCCTGGACTGCTGCAGACTTTATCC
GTGGACTGAAATCTCGCAGTAAATTCGTCGGACCGCTCGT
ATATGTGATTGGCTTAACAAGTACCTTTATTCTTCAGCGA
GAGATCATGGAGCGCGACTCTACCGCGGGAGGGGCAGAGG
ACCTGCTCCTGGAGGACAAAGTTTCAAAACTGCGCGCAGG
ATCGCTTCATAAACACGAACTCGCCGAGGCCATGGAAGTG
GAACAGGAAGGACTGGTAGAACATCAGCCTCTGGAGCAGG
ACGACCTTAACTTTGAGAAATGGAAGCCCAAGCCAAAGCC
CAAGAGGACGCTGCATGAGAAAATAGACGACCTAAAGACG
TACCTGTGGAACGCAGAGACTAAGGAGTTCATGGGCCGCT
CGGGGAAGAGCTGGAGCCTTATTCTTCTCTTCTATGCAGC
ATTATACATTTTTCTGGCAGCCATGTTTGCTGGTTGTATG
TGTTGCCTGATGTGGTCAATAAGTCCATACGCTCCCACCT
ACAATGACAGAGTGATGCCGCCAGGTATGACAATGTTCCC
TCACGTAGACACAGCTCATGGATTTGACATTGCTTTCAAC
GCCTCTGACCGAAGCTCGTGGAGGAGGTATGCGAAAACAC
TGGAAGCCCATCTCAAACCCTATGACGATGGATTGCAGAG
CAGGCGGAACATTGCATGCAAAGGAAATGCATATTTCATG
CAAGAAGACTTGGAGGAGAGTGCCGAGCGCAAGGCATGTC
AGTTTAACAGGTCCTCGCTGGGAGCCTGCTCTGGCCTGCA
GGACAAAGATTTCGGTTACTCCAAGGGAAGACCCTGCATC
CTGGTCAAAATGAATCGGATTCTCGGGTATCTGCCTGGTC
AAGGCACTCCAGTAAATGTTACATGTGGATTAAAGAAAGG
GTCAACTGAAGTCCTCGGAGAAGTCAAATTCTTTCCAAAT
CCTAACTTCGATTTGCGGTACTACCCTTACTATGGGAAAC
TGAGACATGTAAACTACTCCTCTCCACTGGTGGCGGTGCA
ATTTCTTAACGTCCAACACGACACCCCGCTACACATTCAG
TGCAAGCTAAACGGCAAGGGCATCATCAATGATTCACCGA
CCGACCGTTTTCTGGGTAGTGTGTCTTTCACTTTAGAAGT
GGGCGCATAGGATCACAGTAGGCCTAGAGAAATTGATTTT
AAAACTGAGTATGTTATAATAAATGAAATAGCACACTGGG
TGCTGTCTTTACCCATTAGCCCTCTGATTATGCCTCCGGC
AACCACTGTGCTATTCGTGTCAGAGAAAACAAGGAATTTC
CCAGTACGCAAAAAACTGAGATTCTTAGATCACATTCTGT
AACATTCAGTACCCAGACACTAGAACTGAACTGACACCTG
TCTGAATTTCATTATAGGATAAATACACACAAACAAAGAT
GTCCAAATATGTAGAACCCAATTATAGATGAGGCATAATC
ACACAAAAAACATACAGCCTACAGCGTGACTTAGGCTAAA
CAATTCTCTAGGTCTGTGTAGATTGTAGACATTAACATTT
ATTAATTGATCAGTTCTTTTGGTAAGTCAGATGTGTATAT
AACACACGTTAAAACTATTTCTTAATGATTTTTCCCTGTT
AAGGAAAATTCCCCCTCAGGCTGAAAAACGACTTGTGATC
TTTTTTTTTTTTTTTCTTGCTCATTTAATGGAATAACAAT
CAAATGTGGTTTAGGATTAATAATTGATTGTACATTTTAT
TTTTGGACTAAATTGTCTTTATTATTTTTGGATATACGAC
TAAATTTTGATTCCAGAGGAAAAGTATTTTACTGAAATGC
ACAGCAAATCCCATTTCATCGAGTTGATTTTCTTGTTTTG
TTTTTCATCAATTATGCAATCAGCATTTCTTAAAAACTAA
ATGGCAAATTTCACGTAATTCATCTTCAAGTGAAAATATC
TGTTCAGTTGCCTGTAAGAAGGATTTCAACAGTATTATTT
ATTAATTGTATTTGAATATATTGACATGGTACGAACGGTT
ACAAAGTGTAATAGTGAGATGGAAATCGGTAACTGCACGT
CTTTGTTATTCGGTAAATACAATGAAATATCCACTGGCTG
ACAAAGATTTGCCAGCTCATGTTTTTAAACACACTCATGT
TCTAGCATAAACAATAAAGACGGATGAAAATTAACGGAAT
CAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations