Transcript

arl4aa-201

ID
ZDB-TSCRIPT-090929-18219
Name
arl4aa-201
Previous Names
  • arl4a-001
  • arl4aa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037822 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037822|OTTDARG00000027941|ZDB-GENE-040426-1878 arl4aa|OTTDARP00000030315 arl4a-001 LG_ CT027647.21 Danio rerio protein_coding KNOWN, 1090 bp
ATGAGCTGCTACGTGCGTGTGCGTGCAGGCGCGCTCTCGG
TCGGTGAGCACAAGCACAGCAGCAGCACGCAGAGCAATGA
ATGACGATTATAAACCAGGCTTTAACCGAGCATGACGTCT
GAACGGCAAGCTTCGGATGCGCAGTTGGGGTTTTGGACCT
ATGGAGCATCATCCTAAACTTCTGATGTTCTCACACTGCT
GAAGGAAATGGGGAACGGGATATCAGATCAACCCAACTTT
CTATCCAGTCTTCCGTTCTGTAATTCTCTTCACATTGCTA
TATTGGGTCTGGACTCTGCAGGCAAGACAACGGTGTTGTA
CCGCCTGCAGTTCAATGAATTCGTCAACACCGTCCCGACC
AGAGGCTTCAATGCTGAGAAAGTCAGAATACCAGTTGGGG
ACTCACGAACAGTGACGTTTCATTTTTGGGATGTTGGGGG
CCAGGAGAAACTGCGCCCACTCTGGAAGTCTTACACGCGC
TGTACAGATGGGATTGTATTTGTTGTGGACTCTCTGGACG
CCGAGAGGATGGAAGAGGCTAAAACTGAGCTTTATAAAAT
CGCCCGCTCCACTGAAAATCAAGGAGTGCCTGTGCTGATT
ATCGCCAACAAGCAGGACATGAGACAGGCTCTGCCACTGT
CACAAATAGAGACCATGCTGGCACTCAACGAACTGGGACC
CTCTACACCGTGGCATTTGCAGCCCACTTGCGCCATCATT
GGCGACGGCCTAAAAGAGGGACTGGAAAGACTCCATGACA
TGATTGTAAAACGAAGAAAGATGCTCAAGCAGCAAAAAAA
GAAAAAATAGACCCAAATAGACCATAGATGTATTATATAA
ATGAGGAAGAAGAACAGTTGGATAGTTGTGAATTGTCATT
GTTATGTGCCTAGAGTTGGTTATAGAGCCAGCAAGCACTT
TAGCTGTTTACTTTCATATTGTTTACTCTTCTGGATGTTT
ACTATCAGCTAGATTTATATAAACCTAATATAATTGTTTT
ATATATATCACTGATGGATGGCTTCTGTTGGTGTTTTATT
TAGAATGTTTGTTTATTTGCAATAAAAAGGTTTTCTGTCT
TTATTCTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations