header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18193
Transcript Name: alcamb-201
Previous Names: alcamb-001, nlcam-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037793 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037793|OTTDARG00000027920|ZDB-GENE-030131-1768 alcamb|OTTDARP00000030292 nlcam-001 LG_ CR848759.4 Danio rerio protein_coding KNOWN, 3078 bp
CCGCTTCAACAGATGCGACACGTGGGGATCTAACCTCAAA
GTTTGAATTTACTGACGTACGCAACGAGTGTTGTACTTTC
CAGAACATTATCCAACAACGACGCTCGTTAGGCAAGGATA
TTATTTCTCAGGAGTGCAGAACTATCGCAGACTGCAGAAA
GATGCAGCGGACCGCCTTTTTAACGTGTCTGCTCACCGTG
TCCCTCATGAATCAAGTGTGTGGTTTGGAAACGGTCACTG
GCAAGTACGGAGACACTGTTGAAATCCCATGCAACAGTGG
ACTTGTCTCAGACGTAGGAGTCACGTTTGTTAAGTGGAAA
TCTGACAAAGATGGCAGCATTCTGGTAAAACACACGGGTC
AGAATGCCTCCTCTCCCACTGATGGTAACTACAAGAACAG
AGTCAGTATTAAAAAAGATTTTGGTCTCATCATCACACAA
GTGTCCCTGGCGGATCAGAAAACCTTCACCTGCATGGTTG
TGGCAGCAGATGACATTTTGGAGTATCCTGTCCAACTGGT
CATTTACAAGACTCCATTGCAGCCTCAGATTGCAAACCTA
ACCACTGCGATGGAAATCGGAAAGCTGACTACATTGGCAC
AGTGTCATACTGAAGGTGCCAATCCAGCTGCCAACATCAC
GTGGTTCAAGAACAAAACTCCGCTTATTGCTGATGGAACA
GCCATTAAAATCACCAATGATGTGGCTGTTGATAAAGCGA
CAGGACTGTCTGCCACTACATCTAAGCTGGAGTACACTGC
AGTGAAGGATGACATTAATTCCAAGTTTACCTGTCAGGTT
CAGCACATTAAGTCTGCTAACATGGATTCCTCACCGCTCG
TCTTCACCGTGAACTACCCTTCGGAGACGATCAGTTTCCA
TGTGCTGCCCGATGGTCCTGTTAAAGAAGGAGACAATGTG
ACCCTCAAATGCACGGCAGACGGAAACCCCCCACCCTCTC
GCTACAACTTCTACATCAAGGGAGAGAAGAAGACAGTGGA
GAAATCGAACATCTTTATCTTGAGTAATGTAACTAGGCAA
AACACCGGAGAATACAAATGTTCATTGGTGGATAATGAGA
TATTGACGGCGTCTAAAAATATCACCGTTGAATATCTTGA
TGTGATTCTTAGCACCACTGGTGAGGTTTTCAAGAAACTT
GGCGATAGCTTTGAAACAACTCTCGATATTAAAGCTTCAG
GAAAAACAGAAACCTTTTGTAAGAAGGGTGGTGAAAAGAT
GGTTGGCCCTCCTAAATTTGCCAGCTTAAAGTACACAGAC
TCTGGTGTGTATGAGTGTGTTGTTACAATGCTTGGCCTCA
AGAAGACACAGACATTTGACTTGAATGTTCATGGGCAACC
ACTGATCAAGAGCCTGACCAAGAAGCGTGGTGATGGTACA
AACAAGATCCTGAGCTGTGAAGCTGAAGGATCACCAAAGC
CAACGGTGCAGTGGATTACCAATGGCACAGATGTGAAATT
TCAAGAGAGCGAACATGTGAATGGAAAGATCACATACTAT
ATCACTGTCAGTCCAAAGGCCAATGTCACTGTGTCCTGCA
CAATCTCCAATGATTTGGGTTCTGACACGAGGAGCATCGA
TGTGTCGTCGCTTGTTGAGGACGTGACAATGGACAAACAA
GATCAGTCAGAGGACTACAGTGACCAGACGGCGCTGGCTG
TTGGCATTGTTGTTGGCTTGATGCTGGCAGCACTTTTGAT
AGGACTGGCCTACTGGCTGTATATGAAGAAATTCAGGCAA
GGATCCTGGAAAACCGGAGAGAAGGAAGACGGGTCAGCAG
AGGAGAGCAAGAAGCTGGAGGAGAATCAGAGCCAAAAAGC
TGAAGTGTAATGACAAAGACATTCAGGGATTAATTTGATT
AAAATCCCATTTTCCCTGAGAGATGGAAGGAAAAACATTG
GTGGAGTCTGTGAAAAATGGAGTCAGAAGCTGTAATGGAG
GACTTGAGTAGCTGTGTCAGTTACATCACCACCATTGTCT
GTAACGTGTCTGTGCCTCCACATGTCGGGGCATTTAATTG
AATTGAATTCATAATGCGTGTTGTAAAATATGTGAATCTT
TTACATTTGAAGATCCAGCTTGTTCGGAAACCCGTGTCTG
TTAAGTGTTCCTGGGTTTCACATTTGATCGTTGTTTTTAT
TTGATTTTATTTCTTTTGTCCTAGGTATTTAGTTAATGCA
AATTAGTTTTTTGCAGTTTCATATGGTAGAAACACTGTGG
CCTTTAGTGTCTGTAACGGATTTTTTCCTTTAGAATTACA
CATAGTAATCTGTGGCATGAATACGAAGCATGTTTTTTTT
TCTTTTTCCACATTTATACTGAGCACTTGGCTAGTTTTCA
GGTTTTAAGTCAGTGAGCAAAAATATATCCCAATATTATA
CTTGTTGGGACCCCGATGACCATTATTTACCAATATTTAG
ACATTGTATGCATTTGAATGAAGATTTTGCCCTACAATTT
GAAGACATCATGAAAGCCATGCCTTTTGCTTGGAAGCAAA
CAGAAGAATCACAAGAATCCCAGTTAAATTCTTCTTTTCT
TTTTTCTTGGTTTTGGAAAATGAAAAGTCTGTTCTCGATA
ATGTATATGTACATTAACACACTTCATCATCATCGCAGAT
CATCATAAGGTTGTTAATCTTTATTGTTTCGTTTTGCTGC
AGAATGTGTGTGTGCTCTGGTTTAAGCATTACTTGTAAAT
ATGGCAACCTTTTTTTTATTGTTTTTGTTTTATTTATATT
GTTATGGTTTAGCTAAATACCAGTGTTTTGACATGTACAC
TAGCTAGTTTTAGCCAATTTTCCTGAAAATATACCTCCGT
TGCTGTTGAATGGTATGGTGAAATTGATGGTATTTACTTG
CAAGCTTTAAAATTGTGAAATGTAATCTTGCAGCTTTCCA
ACTTTATTGCAGTGTTGCTGCGTTTCTCCTTGAGCGTCAG
CTCAGCGCATTTAATCCACCATCAAAACCAAAGAGGTTGA
ATGTGGCCATGCAAGTATTGTACATACTGACCGTTGTTTT
GTACTCTTAGTTCGAATAAAGTGTACATTTTTAGGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
alcamb-201 Contained in:
OTHER alcamb-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037793 (1)
  • Ensembl_Trans:ENSDART00000101204 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY050561 (1) 3057bp
    GenBank:CU458936 (1) 3019bp
    GenBank:CU458904 (1) 2827bp
    GenBank:DQ279080 (1) 2276bp
    GenBank:CV484182 (1) 687bp
    CITATIONS (2)