ZFIN ID: ZDB-TSCRIPT-090929-18144
Transcript Name: zgc:92590-201
Previous Name: zgc:92590-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037744 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037744|OTTDARG00000027889|ZDB-GENE-041024-15 zgc:92590|OTTDARP00000030254 CH211-261D7.2-001 LG_ CU062628.8 Danio rerio protein_coding KNOWN, 861 bp
CTAAAGCTGTGTGTGAACTGTCCTCTTCTCCTTCACTGCA
ATGAAGATGATTGTGTTCGCTTTGCTGGTCCTGGCTGTGG
CTTGCAGTGCAGATGATAAAATCATTGGCGGTTATGAATG
TTCACCCAACTCGCAGCCCTGGCAAATCTACTTGACTTAT
GATAACGGTCAGCGCTGGTGTGGAGCATCTCTGATTAATG
ATAGATGGGCCGTTTCTGCTGCTCACTGCTATCTTGTAGC
TAATCGTCTTACTGTCCATCTGGGAGAGCACAACGTAGCT
GTCGAAGAAGGCACAGAGCAGCGGATCAAGGCAGAGAAAG
TGATCCCTCACCCGAAATACAATGATTATACATTGGACAA
TGACTTCATGCTGATCAAGCTGAAAGAGCCTGCCGTTTTC
AACCAGTACGTTCAGCCCATTCCTCTGACGACCAGCTGTT
CTTCTGAAGGAGAGCAGTGCTTGGTTTCTGGATGGGGGAA
TCTGATCAACACTGGAGTTGTCTATCCCGATGTGCTGCAG
TGTTTGAACCTGCCTGTTCTGACAAGAGCCCAGTGTGAGG
GTGCGTATGGATGGCAAATCACTAAAAACATGTTCTGTGC
TGGATTCATGGAGGGAGGCAAAGACGCATGTCAGGGAGAT
TCTGGCGGCCCTGTGATATGCAATGGTGAGCTGCGAGGGG
TCGTTTCTTGGGGTTACGGCTGTGCTGATTCCGGCTATCC
TGGGGTTTATACTGAGGTCTGCCGCTACACTGACTGGGTT
GCGTCTACCATTGCAAACAACTAACTATTTCTCTATCCGA
TTGTGGCCATTTGATTACAAGTTAATTTTCTAAAAACATA
TTAAATTCAAATTGGAACCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:92590-201 Contained in:
[BAC] CH211-261D7 (1)

Genome Resources: Vega_Trans:OTTDART00000037744 (1),  Ensembl_Trans:ENSDART00000058945 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CF594919 (1) 902 nt
GenBank:BC083528 (1) 876 nt
CITATIONS (2)