Transcript

zgc:92590-201

ID
ZDB-TSCRIPT-090929-18144
Name
zgc:92590-201
Previous Names
  • zgc:92590-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037744 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037744|OTTDARG00000027889|ZDB-GENE-041024-15 zgc:92590|OTTDARP00000030254 CH211-261D7.2-001 LG_ CU062628.8 Danio rerio protein_coding KNOWN, 861 bp
CTAAAGCTGTGTGTGAACTGTCCTCTTCTCCTTCACTGCA
ATGAAGATGATTGTGTTCGCTTTGCTGGTCCTGGCTGTGG
CTTGCAGTGCAGATGATAAAATCATTGGCGGTTATGAATG
TTCACCCAACTCGCAGCCCTGGCAAATCTACTTGACTTAT
GATAACGGTCAGCGCTGGTGTGGAGCATCTCTGATTAATG
ATAGATGGGCCGTTTCTGCTGCTCACTGCTATCTTGTAGC
TAATCGTCTTACTGTCCATCTGGGAGAGCACAACGTAGCT
GTCGAAGAAGGCACAGAGCAGCGGATCAAGGCAGAGAAAG
TGATCCCTCACCCGAAATACAATGATTATACATTGGACAA
TGACTTCATGCTGATCAAGCTGAAAGAGCCTGCCGTTTTC
AACCAGTACGTTCAGCCCATTCCTCTGACGACCAGCTGTT
CTTCTGAAGGAGAGCAGTGCTTGGTTTCTGGATGGGGGAA
TCTGATCAACACTGGAGTTGTCTATCCCGATGTGCTGCAG
TGTTTGAACCTGCCTGTTCTGACAAGAGCCCAGTGTGAGG
GTGCGTATGGATGGCAAATCACTAAAAACATGTTCTGTGC
TGGATTCATGGAGGGAGGCAAAGACGCATGTCAGGGAGAT
TCTGGCGGCCCTGTGATATGCAATGGTGAGCTGCGAGGGG
TCGTTTCTTGGGGTTACGGCTGTGCTGATTCCGGCTATCC
TGGGGTTTATACTGAGGTCTGCCGCTACACTGACTGGGTT
GCGTCTACCATTGCAAACAACTAACTATTTCTCTATCCGA
TTGTGGCCATTTGATTACAAGTTAATTTTCTAAAAACATA
TTAAATTCAAATTGGAACCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations