Transcript

cadm4-201

ID
ZDB-TSCRIPT-090929-18142
Name
cadm4-201
Previous Names
  • cadm4-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037742 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037742|OTTDARG00000022212|ZDB-GENE-041114-138 cadm4|OTTDARP00000030253 cadm4-002 LG_none CR391920.11,CT867949.6,CR854851.12,CT867948.10 Danio rerio protein_coding KNOWN, 2813 bp
ATGTGTATGTGTGTGTGTGAGTACTAGTATGTAACACACA
ACCGATTCCAGCGAACACTGGAGTTGAGGAAAGACACAAC
TCGTAGGTGAAAGCCTGCGCGCTCATGTTATTCTAATTCC
CATCAGAGGAAGAGGAATAAACTGAGAGATCGGAATAACA
CACACATGATGATGGCATTTTCTTCTGTTTGGAAGTATTG
GGCCCCGCTTCCTCTCCTGCTGCTCCTGTACTCGCATACA
GCGAGAGGGCAGGCCGTCCAGGCGGAGAACGTGACCGTGC
TGGAGGGAGGAACGGCTCAGATCTCCTGCCGTCTCCAGAA
TTATGACGGTTCAATCGTGGTCATCCAGAACCCACGCAGA
CAGACGCTCTTCTTTAATGGAACACGAGCGCTGAAAGATG
ACCGTTTTCAGATGGTTCTTTTTACGCCGAAGCTGGTGCG
CATCACGTTGACTAATGTAAGTGTGTCAGACGAGGGTGGC
TACTTCTGCCAGCTCTACACCGATGATACACACCACCAGG
TGGCGACGCTGTCGGTGGTGGTGCCCCCGGAGGTACCCAG
CGTGGAGGTGAAAACAGAGGCGGTGGAGGGAGGAGAGGTT
GAGCTCACATGTTTGTCCCTGCGGAGCAAACCTCCAGCCA
CACTGCGCTGGGTTCGAGACCGCAGAGAGATCCCAGGTGT
GATCTCCCAGCAGGAGAATGGCAAGACTGTGAGTGTTTCC
AACACTATCCGTATCCCCGTGGAGAGGAAAGATAACAGAG
CGGCGCTGAGCTGTGAGGCGTCTCATCCCGCACTCGTGAG
CCAGAAGCGAGTTCGTCACTACAGCCTGGACGTTCACTTT
GCTCCTACGGTGAAAATCGTTCCCCCTCAGGGCATCCTCC
GAGAGGGAGACTCCCTCAGTCTCACCTGCTCCGTTACCGG
AAACCCACTACCACGTGACATCCAGTGGTCACGAGTGAAC
GACACTCTTCCTGAGAGGGCGGAGAAAACCGGCAACATCC
TCCACATGTCTCGCCTCAGCCAATCACACAATGGCACCTA
CCTCTGTCAGGCACATAATAATTACGGCCGTGCAGCTGAT
CACTACACACTGCTGGTGTATGTGTCTGTTGCTCAATCTC
ATCCTGCCATCGCTCACCCCAACCTTCCATCCTCAAAGGA
ATACCAAGATCCTGGAGCAGTGGTGGAGACCCACAGTGCC
GTCCCGTTTGCAGTGATTGGGGGCATCCTGGCCCTGCTGG
TCTTCACTGTCATATGTGTGCTCATCGTCACCATCTGGTG
CTCCGTCCGGCAGAAAGGTTCTTATTTGACTCATGAGGCC
AGTGGTTTGGACGAACATGGCGAGGTTCAGGAGGCCTTCC
TCAACGGAAATGATGCCAGCCAGGGCAAGAAGGAGTACCT
ACTGTAGCGCTGCCGTGGTGGAATTCTTGAGAAACACTGG
ACCGCTGCAGACTGCACACCGCAACACACACTGTTCCCAA
ACAGACCTACACACCACTACTACAACAACCAGAGGGAATC
ACAATCGTGCCATATGAAGGAAGATGGAGTGGGAAGGAGA
GGACGGAGATATTAATGGAGGAGCGAGAGAGATGAAAGGA
GAGAACAATTATTCTGACTGAAAAACACCATCATGGTCAC
TCTCTTTTTTTAGTTGTGACAACTAAACTGTAATTGCAGG
ACCAAGAGAGAAAAGTGTCCATTTCTAAACAGTGCCTCTA
TGGCTTATGAGGTATTGAATGTCTCAAAGTGAGCAAATTG
AAATCTTCTGCATTTTTATGCAGCACTGGGCCTCAGAGAC
TGAGCCGGTAGAGAATAAATCCACCAACAACAGCGCTGAG
AGCTCAGAGCCGTCCTCATAAAGTATTTATCTGCGCTTTT
CATCCAGCAACTCCATTATCTGCTCACGCTGGCCAAAACC
TGTTGACTTGTGAAGAAAAGTTCCTCTCGTTTTTGATCCT
CTCTCGGTGACTCTCTCCAGCGCTCCTTCCTCTCCCTCCT
CTATCTCTCCACTATTGTTTGTTAATAATTAAGGGATTAG
ACATGTTCTCTTTTATGAGCCGAATGAATTGAAGCAGACC
GCTTGCTTCAACGCTGTAAAAAAGGGGGCTTAATTATCGC
AAAGTCATTGGAAACGTGGAACCGCGACTTGGGTGAGAAA
AAAAGACAGTTTGTCGAGAACATGTCGGAAATTACATTTT
TTTGTTTTGTTTTTTGATTGCTCCACACAGAAACACACAA
TGAAACATATCTCTAAAGTCATTATTTGTATGAAAAAGTC
TACAAAGTAAGTTAAATGACTCTTTTAAGAAAAAAAAAAA
AAACTTTTGCGCGCATTACCGAGCGATGCTACCGTACTAA
CACAGAATATTAGCTTAGAGGTGCAAAACTGAACAAACTA
CTGTTACGTCATCTTTAAAAAAAAACTTGCAAAATTAAAA
AAAAAAAATATCTATTTTGTTTGTCTTTAAAAGATATCAG
AGGTCTTAATTGTTTTGATTAATTATTATTTGGACTATTA
TGATCGTTGTTATTGTTATTATTATTCTTACTGTTATTAT
AATTGTAAATGTTATAAATTGTATACTTCCCATGCTTTAG
TTCTACCAGTAGAAACAGCCGTGTATACCCACTTTTCTCT
CTCCTCCACTTTTCTCTGATCCTCTTTGTGTCTTTCTCCC
TCTTCGTCCGTCTCCTCTTTGTCTTTCACTTCCTGTTTAT
TTTATAGTCTTTGCGTCGCTGTTGATATAGCTAACTGTAC
ATCTTTATAGGGGAAAGATACCAAGCACGACAAAATAAAA
AATACTTAAAAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations