Transcript

rtn4rl2b-201

ID
ZDB-TSCRIPT-090929-18116
Name
rtn4rl2b-201
Previous Names
  • rtn4rl2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037716 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037716|OTTDARG00000027874|ZDB-GENE-040310-2 rtn4rl2b|OTTDARP00000030231 rtn4rl2b-001 LG_ CR812832.10 Danio rerio protein_coding KNOWN, 2535 bp
AGAGCTGACCGATAGAGCAGATAGCAGACCCCGATCAGGC
TAACTCGCTCTCGGTTTGGATTTTGGGATGACAACTCGTG
CGGCTGCGCGGAGCGCTCGTGCCTCCAAAACTCTTACCTT
CAAGAGTGGTTTGACTCTATGGTTGGTGATATGGCTGTTG
GCATGTCGCTGTGCACCAGGTCAAGCATGCCCCAGGTTGT
GTGTATGCTACCATATGCCCATGACTGTGAGCTGTCAGTC
TCAGAACTTCACTTCTGTTCCTGCCGGTGTGCCCTATGAC
TCCCAGCGTGTCTTCTTGCAGAACAACCGTATCACTGAGC
TCAGAGCGGACTCTTTTGGCTTTGAAACACAGGTCCTTTG
GCTGTACTCCAATAACATCACATGGATCGAAGCAGGTGCA
TTCAGTAATCTCCGTGTACTAGAGGAACTAGATTTGAGTG
ACAATCCATCACTGCGCAGGTTGGATGGGGGTGCATTCAG
GGGGCTGGAGCGCTTGCAGAGCCTCCACATGCACCGTTGC
CACCTGACCGAGCTGCCTGCTGACCTCTTCCACAAGCTCT
ACAGCTTGCAGTTCCTCTACCTGCAGGAAAACCAGCTGAC
AAACCTTCCCGATGGCCTCTTCTCTGATCTGGTCAACCTC
ACCCACCTTTTCCTGCATGGCAATCGCATTCGGACTGTGT
CTGAAAATGCTTTTCGTGGTCTGGTGAATCTTGATCGACT
GCTTCTGCATGACAACCGCATTCGGCAAGTCCATCGGCGC
TCCTTCCGTGACCTGGGCAGGCTGACCATCCTCTATCTCT
TCAACAACTCTCTGCAGGAGCTTCCTGGTCAGGCGTTAAG
GGATACATCATCCGTGCAGTTTCTCAGGCTCAATGGAAAC
CCCTGGACCTGCGGTTGTGAAGCAAGGTCACTCTGGGAGT
GGTTCCGCAAAGCTCGGATTTCCAGCTCAGACCTAACCTG
CTCTTCACCAGCCCCCCGTAAAGGCCAGGACCTGAGATTC
CTGCGGGAGCTAGACTTTGCTCTCTGCCCCTTGCCTGACC
CAGGTTCCATGGCAGGCACTACAACCACCACTTTCAGCAC
CAAAACACGTTGGTGGTTCTCAAAGAACAAGCCAGCCTCA
TCATCCAAGAGCCACTTTCATAAGAGCAGTGAGACCTTGA
AGGCCTTCCCATTCAACTCTGGCAAGAATCCCTCATCTTC
ATCGACTTCCTTCTCATCCAAGTACGATCTCACAGCAGAG
GAGGCTGCCTTACCCAAGCTGGAGCCTGAAGAGTACTGGG
CAAACTATGGAAATGAGGATGCAGCCTCAGTTCGCTGTTT
CGAACTTGAATGTCCACCAGGTTACGACTCTCCCATTCTC
CCATCTTCCTCTTCGTCTTCACTTCTGTCTTTCCTCTCAC
TCACAGCACTGACTCTTTCTTTCCATCTGCTCTTCGGCTG
AGTCTTTTTCTCCTCCTCTTCCTCTTCTGTTATCCTACAC
TACCTTTCTCCTGCGATCGGGCTTATGCTGATAAATGCAT
ATAAGCAGCAATGCAGAAAAAAAGGGTGACAAGAAACTGG
CACAGAACAACAACATTTATACAACGCATACTGTAAGGTG
CAATATATGCAGAACAACTGAGCCAGGGATGAAGCATGTG
TGCACCCCCAAAAGGCTTTGCAACACCAGCTCAAGTCATG
TCCTTCTCTATAATGAGAGAATATAGGACAAGTAGAGGGG
TAAAGAGGGACTGATGTGGTAAATGAAACTAGAGGTAAAG
ACGGCAAGGAAAGTCTCGACACAAAGAGAAAACTCTAAAA
CCAGCAACTGAGACTGTACCAGTTATGAATGACCGTCACA
TTGTCATGTACATAGGAACTATTCAGACGAATTAGTCCAA
GAGAGTAAATATGTTCTAGTCATTAGATTAGAGAGTAGTT
CTCTTTGTATTTTTGATGATCTTTGAGCACTACATCAGAT
TCGTCATCACATACAGTGGCTCCAAAATATATTTTTAGAC
ACTTAAGCTCCAACAAAATGTCTGAATTTTAAAAAGAAGG
TTTATATGGTAACAAGGTTTATTTATACGGTTAAGGTTTA
TTTATAACAAAGTTTATATGATAAAACAATAGAGAGACTG
CATTTAGACATTCTGGTTGTTTTAGAGTAATGTGCATAAT
TATTGGCAGGAACTTATGGCAGATGCCCCTAGCTTTGATT
TTGGCTTTGTGTCTAAAGACTTTTGGTGCCACTGATAAAG
ACGGTAACTAATGTTTTCATTTGTTAAGTCTGTGTTAAGA
GCTTTGGTTCGTGTTAGTTAATCTGAGTTGTGCAGGGTAT
CAGGTGAAGGAAGTCAATGTTTAATTCAACCTGAAGAATT
AAGGAAGCATTTGAGGCGAGAGATCTGTGTTTTCTCTGTT
TAAGATAACGCCTAGTCTTTCTCTCAGAGCAAGTGTTCAG
CTGTTAACAAAATGTCAAACACAGTCATGCCTTCTGTCTG
AAAACATGTAAATAAAACCACCGTGAATAAAAAATAAACT
ATCTTTGACATATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations