Transcript

dhrs7-201

ID
ZDB-TSCRIPT-090929-18067
Name
dhrs7-201
Previous Names
  • dhrs7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037666 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037666|OTTDARG00000027842|ZDB-GENE-060825-21 dhrs7|OTTDARP00000030193 DKEY-15F17.6-001 LG_ BX072537.8 Danio rerio protein_coding KNOWN, 1299 bp
TGTTGTTTCGGAAGAAGCCGTTAAGCATGTCATAAGTTGT
AGCGCAGGGATTTGTCAGCGCTCCGGTTGCGCAAGTTTCA
CCAGTGCTTCCGTCACTCTGTGAAGGCATAACAAGTGAAG
TGTCTCGATGGATATATGCTGGCTGTGTGTTGGTCTTGCT
GGGACCGCAGTTTATTTACTAGTGCAGTTCATACGCTTCA
TTTTCGCCGACGCTGATCTGACTTTGTTATGGGCGGCCAG
GTTCGGCAAAACACCAGAGTCAACGTTTAGAGGTAAAGTG
GTGTGGATTACCGGAGCCTCCAGTGGCATCGGGGAAGAGT
TGTCTCTCCAGCTGGCTGCGATCGGCGCTCGCCTGGTTTT
GTCTGCCCGCAGGGAGAATGAGCTGGAGAGGGTGAAGCGC
CTTTGTTTAGAGCGCTCCTCTCTAAAGGCTGAGGATATTC
TTGTTTTGCCACTGGATTTAATGGACCGCGCATCACATCC
AGAAAAAACCACAGCAGCTCTGGAGCACTTTGGTGAAATC
GATGTGTTGATAAACAATGGTGGCCGGAGCCAGCGTGCTC
TGTGCGTTGATGCGGATGTCGATGTGTACCAGGCTCTTAT
GGAGCTCAACTATCTTGGCACCGTGTCCATTACCAAGCAG
GTGTTGCCCCACATGATCCGGCGTGGCACTGGTATCATAG
CAACTGTCAGCAGTGTTGCTGGCTTTGTAGGGGCACCCTT
GGCAACAGGGTATGCGGCGAGCAAGCATGCACTGCAGGGC
TTCTTTAATTCTCTGAGAACTGAACTTTCTGATTGTCCAA
ACATCCTGATCAGTAACATCTGTCCCGGACCTGTAATATC
AAGCATCGTTCAAAACGCCTTCACTGAGGAGCTGGGCAAG
CCAGTGGCCACAGCTGGTGATCAGACGCATAAGATGTCTA
CAGAGCGCTGCGTTCACCTCACTCTAGTGGGTCTGGCCAA
CCGTGTGAAGGAGATGTGGATCGCTGAGCAGCCCTTTTTG
CTCTTCTGCTATGTGTGGCAGTACACTCCAACACTGGCCT
GGTACCTGACTAATGTTCTGGGCAAAAAACGTGTGCAGAA
CTTCAAAGCTGGAGTGGATGCAGACGCAGCATACTTCAGC
AAGCCAAAGGCCAAGACATCTTGAAAATTTCCTCAAGAAT
CAGCAATGAGGTCGGCACTCATAGCTTCAAGGGCAAATTT
CAGATGTTAGTTTTAGCCCGATAGATTTATGGATATCTAA
AAGCTTGTGTGCTCCAAAATTCACATTTACAAAATATAAA
ATTCATATAAACATTCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations