Transcript

zdhhc20a-201

ID
ZDB-TSCRIPT-090929-18046
Name
zdhhc20a-201
Previous Names
  • zdhhc20a-001
  • zgc:162723-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037645 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037645|OTTDARG00000027826|ZDB-GENE-070424-38 zdhhc20a|OTTDARP00000030174 CH211-102B8.1-001 LG_none CR376845.7,CR925771.6 Danio rerio protein_coding KNOWN, 1730 bp
ACCGGCACCCTTTCCGACACTCGGATTAAAGATGGCGCCC
TCTCATGCGGTAAGATGCTGTCAGCGGGGTTTATCCTGGA
TACCTGTGATTTTCATCAACCTGGTCGTTTGCTGGTCCTA
CTACGCGTACGTGGTGGAGCTCTGCATCTACACAATCCCG
AACGTGAACGAGCAAGTTATTTATCTGGTAGTCTTTCATG
CTTTTTTCTTCATGTTCATGTGGTCCTACTGGAAGACCAT
CAGTTCCAAGCCTACAAACCCCTCAAAAGAGTTCTGTCTC
CCTAAGGCTGAGAAAGAGCTGTATGAGAAAGAGGAGAGAC
CAGAGGCCCAGCAGGACATCCTGAAGAGAGTGGCCAGAGA
ATTACCTATATATACATTCACAGGATCTGGGGCTATCCGC
TACTGTGACCGCTGTCAGTTGATCAAACCGGACAGATGTC
ATCACTGCTCGACCTGCGACAAATGTGTCTTAAAAATGGA
TCACCACTGTCCATGGGTCAATAATTGTGTTGGATTCTCC
AACTACAAGTTCTTTGTGCTTTTTCTGGCCTACTCTATGC
TGTACTGCGTCTACATCGCCGCCACAGTATTGCAGTACTT
TATCAAGTTCTGGACCAATCAGCTGCCTGACACTCATGCT
AAGTTCCATGTGTTGTTCCTGTTCTTCGTGGCGGCCATGT
TCTTCATCAGTATCCTGTCACTCTTCAGTTACCACCTGTG
GCTTGTGGGGAAAAATAGAACCACTATAGAGGCGTTCAGG
GCACCGGTGTTCAGAAATGGCCCAGATAAAAATGGCTTCA
CACTGGGTTTCCGCAAGAACATCACCCAGGTGTTCGGAGA
CCAGAAGAAATACTGGTGCTTGCCCATTTTCAGCAGTTTG
GGTGATGGTTACACCTTCCCTACCCGCCTAGTCACTGTTG
ACGTGGAGCATGGCAACATTGAACACCAAACCATTAAATG
CACTGTTGATGGACAGACTAACGCCAGACCTCTGAGTGAG
TCTCAGAATCATCTGCTCTGCAATGATGAGGGCCAGAAGG
ACAGCAGCATGGCCGCCATCGAGGTGTGTCAACCTGTTTG
TGTTACCTTGGAGAACGAGTCCTAATCCAGGAGTTTTCAG
TGGCACTGGGACATCTTTCCTCTCTTCAGGATGTATTGTT
TCCTATAAGACCTCACGTGGAAGACCGCAGAGCCCTCAGA
TACAATGCCTTAAGGTTAGCATTATTTCCAGGAAAGACCA
GTGCCCTGGTGGATGTTTATGTATCCGACTCTCAAGCTCT
TCACACCAAACGGATCTTCATAACTCACTTTTCCATTTGT
CCATCTGTCTGACCAAAATACCCTAAGATGACCTTCAAGT
TTGATTCTTAGTCCTAAATACAATGGTTAATCTCGGGGAC
TGCTTTATTTGTGTAGGCCAAAAACTCAGTCTGGCGTTTT
TACCCAAGATGCACTTTCGTGTGGAATGGTTTTGCAGATG
TTTACGGATCTAAATTAACATGTGCGAGTGCAATGCAGTA
TTTGATCAGAATGTGTTCATTCACTACAGCAACATCACCT
CAACTAATACTGTAGATTATGTAGTAGGTATTTGTTTGAG
TGATAATTCAGAAGAAAGTGCAATGAGGCGTTTAATATTT
TAGATAATTACAAAACTGGAACGCTTTATAGTGTTTAATA
GCTACTTTGTTTATACATGTATACACACACACACACACAC
ACACAAAAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations