ZFIN ID: ZDB-TSCRIPT-090929-18040
Transcript Name: zgc:153981-201
Previous Name: zgc:153981-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037637 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037637|OTTDARG00000027820|ZDB-GENE-061103-367 zgc:153981|OTTDARP00000030166 CH211-223P8.3-001 LG_ AL929005.7 Danio rerio protein_coding KNOWN, 1760 bp
CGCAGCTCTGAGATGCTCAGCGGTATCGGGTAACCGAGCA
GCGTCATAAAGAGCACCTGTTTGTGTGGATCACGACGTGC
CAAACGGGTTATGTATGCTGAGCCCCCGGGAAAACAGCAG
AAACACATCTTCACTGGCATAATACTCGGATCTGGGTCAA
TTCGGCACAATGACAGCTCAGAAAAACAAGCACGGTCTCC
TGCCTATTAAAGAGTTGGAGAATGTTCTGGACACATGTAA
ACTTGACCTAACTCCAGTCGACGAGGTCTGGCCAAACCTG
TTCATCGGAAACGTGGCCATTGCTCAAAATAGAAATGCTT
TGAAGAAAATGGGAATCACTCACGTTTTAAACGCTGCTCA
TTCCAAGCAAGGCAGCATCGGGGACCAGAGTTATTATGGC
AATTCAATTGTATATTATGGCATCCCAGCAGAGGACTCTT
CATCATTTGATCTTAGTGTGTACTTTAAAACAGCTTCTGA
TTTCATCCACAAAGCCTTGAGGAAGAAGAACGGAAAGGTG
CTTGTTCACTGCATCATGGGAATGAGTCGATCTGCAACTC
TGGTTCTAGCATACCTTATGCTGCGTCAGCGTCTTACCCT
GCGCACTGCCATCCAAACAGTCGTACTGCGACGTGCCATC
TATCCCAACAGGAACTTTTTGAGCCTTCTCCTGGATTTGG
ACATTCAGCTACAGAGAAAGCGAATGCTGTGCCCTATTCT
CTGACAGAAAAACACAGATGCCATGAGCACACTAATGCCT
GTGCATTCATTTTATATAACTAGAGGATGAAGAGTTAGCC
ATCGTTGGTATGTTTACATTATTTACGATAAGTGTACAGT
ATATAGCCTATATTGTTTCATAGTAAAACTGGTGCCTTTG
GGGTTTAGTGTATGTTGCTGTATAGACCATCTTTGTACTT
TTCCATAGATTTACAGGGTTAATTTTAATATTTGCTATAA
TTTAGCTATAAAACACTTTTTAATATTGAATAAGTGGCTT
TGCTTTTAACTGAAACAATATTTAACATTTGTCCTTCTTG
CATTGCCATTTAAACAGATTTTTCTGTACAATGTCTTGTA
AATTTGAGAATGATGATTTTTATGAATCTTTATATGATAT
ATTCAAGATGCAGCTTTATGAACAGCACACAAGTGCCACA
TGATCCTCACATTTAAAATGACATTTAACTATGGAGTCAG
TATTCAGCACAGTGCACTAAATTAAGCAGTATTAAATGAT
TGAATTGTGGTTTATTATTCAGCTACAGAGAAAAGCCTGA
CTGTGAGCTGTATGAGCTTTTACGTTGCTTTTGGCAGCCA
AAATTGGAGGAATCTATGGGCCAAGCACAACACTCTTCTG
TTGACTCAATCCTAACAGCCTTGTTTAAATGACTGAGCAG
CACTCGTTGATGTGTTTTTAGTGCACCTTTTTGTTTTAAC
AGTAGAATAATGTTTCATTCAGCTCATTGATTCACAGACG
TTCCTTTGTTATCTTAGAGAACATTAATGGAGTGTAAACA
GTTTTTCCAAAAGCGCTGTATAGTTACAACATTTAATTGC
ACATTTGACTCTTTCAGCTATGAGCAGGATGAATATTGAA
TTTGTTACACTGTTAGTTATGTCTGAATTTGTATGTATTT
CTGAAGTATAACGACTGATATATGGATGTTTCATACAAAC
AAGGTGCCAAATAAAGTTAATATTCATCTGTGTTCATTTA
AATAAAATAAATGTGATAGTGCTTTGGGATAAGCATTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:153981-201 Contained in:
[BAC] CH211-223P8 (1)

Genome Resources: Vega_Trans:OTTDART00000037637 (1),  Ensembl_Trans:ENSDART00000101274 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC125928 (1) 1851 nt
CITATIONS (2)