Transcript

ints2-201

ID
ZDB-TSCRIPT-090929-17964
Name
ints2-201
Previous Names
  • ints2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000037555 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037555|OTTDARG00000027781|ZDB-GENE-050522-148 ints2|OTTDARP00000030101 ints2-002 LG_ CR925779.11 Danio rerio protein_coding NOVEL, 1089 bp
AGACGCAGCCAGAGTTCAGCATGCTCACAGCGGAGCAGAT
GATCGCTTGTGCTAAAATCATTACTTTTTCTACTTTATAG
CTTGCTAAGCACTCTGGCCGACACATGTGGGTTTAATATA
GAGTAAGTGGATTGTATTAAGCATATTATTATTTTAAATA
TATTGCTTCATTTAGTTAAATCGGGATGAATGGATCTCTT
AAGCAGGATAGCTTTAGCAGCTAGCATGTTAGCTTACCGG
TGAGCTGTCCTATTTCGACCGAAGAAGATCAACTTCCTTT
TCAGAGAAAATCACGACAGACCGCGGTCTTACAGGCCTCA
GCGGGTTTCTTTTGTAACCAGCGGCGCTGTTGAAGTCTAG
AAGAATGACAGACAGTGCCAGTCTTCAGTTTGTGAGCCCG
TATGCATTCGAGGCCATGCAGAAGGTGGATGTAGCCCGAC
TGGCAGCTTTAAGTGACCCAGAGCTGCGTCTCCTTCTGCC
CTGTCTGGTCAGGATGGCTCTCTGTGCCCCTGCAGATCAG
AGCAATGCCTGGGCACAGGATAAGAAGCTCATCCTGCGGC
TGCTGTCAGGGGTGGAGGCGGTGAACTCCATTGTTGCTCT
GCTGTCTGTGGATTTCCATGCTTTGGAGCAGGATGCTAGA
AAAGAGCAGCAGCTAAGGCATAAGGCTGGAGGATCTAATG
GCGAGAGCATTCTGGTGTCTCAGCTTCAGCATGGTTTGAC
TCTGGAGTTTGAGCACAGTGATCCTCTCAGGAGACTCAGA
CTGGCTCTCAGTGAGCTGCTGGCCATTATGAACAAGGTTC
AGTGTCCTTTTATTTATTCCTGCATAGGGATGCTCATTAG
GGTAATTTTCCCAACCGGCGCTCATTAATCGGATATTAAT
CGTTAACTGGGCAGATTAAGATGAACTTATTATTTAAATA
CAAAAATGAATTGAGGTGTCTATTTTGGATCTGACACATC
AAATATTGCATTTTGAAAAGCTGATTTATTTTAACGTGCA
AACAACAGCATACAGAACATATCAACAACAGAACATCTTC
AAGCAGTAGTGTTTTTAACAGCATAGAAAAAAAAATACTG
AATAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations