header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17946
Transcript Name: oprd1b-201
Previous Name: oprd1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037537 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037537|OTTDARG00000027768|ZDB-GENE-030131-8473 oprd1b|OTTDARP00000030083 oprd1b-001 LG_ CR855299.12 Danio rerio protein_coding KNOWN, 2362 bp
GACTAGTGGAGTTGATGTCCTTAAATCTGCTGCTCATGAT
CTTACACCTTTCATTTTAAACAAACACTTTCAACATTTTA
CAGTTTCACTTAATTAGAAGGCGTTCGACATATAGGGGAC
GAGCATAATGGAGCCTCCAACAGTGACTGTCAGCGATTTT
TCCGAGCGTTATCCTTTATTTCTGCACAACTCGAGCTTTC
TGGAGGAGCCTGCGGGACTTCTGTCCAACTGGAGCGGAGG
AAGCAGTGAGCTGAAGGCGGTGAGAGGCAGCAGTGCGGTC
GCTATCGCTGTCTCCATCACTGCGCTATACTCGGTCATCT
GCGTTGTGGGACTCGTTGGAAATGTGCTGGTTATGTACGG
AGTGGTCAGGTACACGAAGATGAAAACCGCAACCAACATA
TACATCTTCAACCTGGCATTAGCAGATGCGTTGGCCACCA
GTACATTGCCCTTCCAGAGCGCCAAATACCTCATGGGCAC
CTGGCCGTTCGGCGAGCTCTTGTGTAAAGTGGTCATTGCT
ATTGACTATTACAACATGTTTACCAGTATTTTCACGCTGA
CGATGATGAGTGTGGACCGCTATATTGCCGTGTGTCATCC
GGTGAGGGCCCTGGACTTCCGCACGCCTGTCAAAGCCAAG
ATCATCAACATCTGCGTCTGGATTCTGTCCTCCGCTGTCG
GCTTCCCCGTCATGGTGATGGCTGTTACTAAAGAATTAGA
CTCAGGCAAAACAATCTGCATGCTGAAATTCCCCGACCCA
GAATGGTACTGGGATACAGTGACCAAAATCTGCGTTTTTA
TTTTTGCCTTTGTGTTTCCCGTCCTGGTGATCACCGTCTG
CTACGGCCTGATGATCCTGCGGCTGAAGAGCGTGCGCCTG
CTCTCCGGCTCCAAAGAGAAGGACAGGAACCTCCGGCGCA
TCACCCGCATGGTTTTAGTGGTGGTGGCGGCATTCATCAT
CTGCTGGACCCCCATCCACATCTTCATCATCGTCAAGACA
GTGGTAGAGATCGACCAGAAGAACCTGCTGGTGGTGGCCT
GCTGGCATCTGTGCATCGCTCTGGGCTACATGAACAGCAG
CCTCAACCCGGTCCTCTACGCTTTTCTAGATGAGAACTTC
AAGAGGTGCTTCAGAGAGTTCTGCTTGCCTTTTCGCACTC
GCATAGAGCAGAACAGCTTTTCCAAAGCCCGCAGCGTCAT
CAGAGAGCCCATCTCTGTCTGCGCCAAATCAGAATCAATC
AAGCAGCCCACATGACTAGACCTGGACCGGATGACTCCTA
GTACACAGAAAGACCCGCAGTCCGAGGTAACCCAGATCTC
TACAACTGAGTTTTAAGCTTATCTGGCCCATAAACTGCTG
GCAGAATGTCATGTTGGGGCATTATTTATATTTTATTCTC
ATCGTTCTTGACTGAAAAGTATGGATGGCCCTGAAATGAT
CTGCGAGATATTTTCCTAAGTGAGGAAATGAGATGATCTG
GACCATCAAGATGGTAATCATGCATTGGAAAAGACATCAA
AGACCTGACCAACAGGAAATTTACATTCATTAGTGGTATA
TGAGCCAATACAGCAGATTCCCCTAATGAGATTTTTTTTA
TATTGCAAGTTAATGCATTTCCATGGGAATTGTGGGATTT
TATGATACATTGAATAATCAATTCTGCTTTTGAAACAACA
AAGTGAGCTGTAAGATTTTTCTTACAAGAGCTTGTTACAC
AGAAAGATGAAAATGTACAGTTTTTGAGCTCCTGTTGTAG
ACAATAAAAGTTTTTTTTTTTTCTTAAAAACCAAGACATA
TGGAGAAACATTGGACTTTAGAATGGACATTCCCTTTGAT
TTTCATGGATGTCAGCGGATGTTCTTCCTTTTGAAAACAT
AAACTCTGAGCATTATTCATTTCATGGTGCTTTATAAAGT
CAGTTTGTAAATTTGCGCTACTAGTGAAGGTGTTTTAAAA
CCTTTGACTATGAAGAAACGTTTTTAGCTCTTTTAGTATT
TAGTGGACGAAAATCTTGCATTTCTTTGCCATTGGCGCAG
AATGGCTGTTTTTATGACCTTCTTCAAATTCTAAAGTTGA
AGTGACATTTAACGAATCGTCTCATGATGTTAGTGTTGGA
TTTAAAATGTCAGCTTTGCTGTAAAAGGAGATGGTTTAGT
TTCTTGAGCTGTAATAGGTAAACTTTTTTCCAGCCAAGTG
TGTTTATGTATTAGTTTTGCTTTCCTGTATTCTGCTTCAG
TGATCTGTTCTCATGAATCTATTTTTATGGACGCATGGAA
ATTAGACATCACAAACTATCTGATCTGTCAGTATTTGTTG
TGAAAGTTCAGAAAAAATAATTAAAATCATTCTGTAGATT
AA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
oprd1b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037537 (1),  Ensembl_Trans:ENSDART00000054037 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AY262256 (1) 2364 bp
GenBank:EH580454 (1) 915 bp
GenBank:AI384160 (1) 406 bp
CITATIONS (2)