Transcript

or137-7-201

ID
ZDB-TSCRIPT-090929-17771
Name
or137-7-201
Previous Names
  • or137-7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037348 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037348|OTTDARG00000027681|ZDB-GENE-070806-27 or137-7|OTTDARP00000029926 or137-7-001 LG_ BX649282.8 Danio rerio protein_coding KNOWN, 930 bp
ATGAACTCCACAGTGCTTTTATATAGTCAACAAGAAAGAT
ATGCAGATGCGTTTGCTAAAAATTTTTCCATTGTTTTGCT
TGCTGTTATAATCATCTCCATTAACGGAATGTTTGTATTC
ATATTCTTTAGGAGATCAATTTTCCACAGTGATCCACGAT
ATATACTGTATATTCACTTGGTTATGAATGATATGCTCAT
GGTTTTTATTTCTGTAGTTCTTTTTGTGATGACTTTTGCA
TGGCACAATGTGCCTGTCCCGTTCTGCGTGTTGCTCCTGT
TAATAACCTCGGTAACTCATAGGAACACTCCTCTGACTTT
GGCTGGTATGGCTATTGAGCGTTACATTGCCGTCTGCAAA
CCACTGCATCACCATCAGATTTGCACAGTGCGCTGGACGT
ACATGCTCATCTCTCTCATATGGAGTGTTGGAATTTTACC
TGGATTGACCGACATTTTTCTCCTTTTAATTAATGGACCT
TTGGCTCTTTTTACAACTATCTGTACTTCAGTAATTCTTT
ATAACACACCAAGCCATGCTGAACTAAGCAAAATTTCGAA
TGGAATTTACTCATCTATTGTGTGGCTAATACTCGTATAT
ACATATTGCCAAGTGATGGTTAAAGCCAAAAGGTCTTCCA
CTAATAAATCCTCAGCAAAAAAGGCCCAAAGCACCATCCT
GCTACACGGAGCACAGCTTCTGCTCTGTATGCTGTCCTAC
ATTACTCCTGTGTTAGACAAAATTTATGCACCACTCCAAA
CTGAACAGCAGAAGAAAATAAACTTTTTCAACTACCTACT
AACTAGTATTTTACCAAGACTTCTTACCCCCCTGATTTAT
GGTGTTCGGGATAAACAGTTTTTTAATCACATCAAGGCAC
TCCTTACATGTAAATTATCTGCTGTAAATGTTGATCCAAT
CAAACAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations