Transcript

or134-1-201

ID
ZDB-TSCRIPT-090929-17768
Name
or134-1-201
Previous Names
  • or134-1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037345 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037345|OTTDARG00000027678|ZDB-GENE-070806-22 or134-1|OTTDARP00000029923 or134-1-001 LG_none BX957318.7,BX649282.8 Danio rerio protein_coding KNOWN, 948 bp
ATGAATTCAACAGCAGGCCAGCAGCTCCTCCTGAGAGACA
CGTTCGCCATGGCCTTCATGAAGAACTTCATCGTAGTTTT
GGTGTGGTTTCTTCTCAGCTACATCAATGGCAGCGTAGTG
GCTACTTTCTTCCGACACCAGATCTTTTACGAGGACCCTC
GCTATATACTCTTCATACACATGGTCATTAATGACGCCGT
TCAGCTCACTGTGACCATCGCTCTATTCTTGGTCAGCTAC
ATCTTGTATACTATCAGTGTGGGAGTGTGTTGTTTCTTCA
TCCTGGTGGCCGTGTTTACAACCCGTAGCACGCCTGTTAA
CTTAGCCGGCATGGCTATCGAGCGATATATCGCGATTTGT
TATCCTTTACGACATGCTCAGATCTGCACTGTACATCGTG
CTTACGTGCTCATAGGTGTTATTTGGTTTGTATCTGTAGT
TCCTGATATCACTGACCTCTTTGTGACTCTAGCCACAGAA
CCACTGAGTTTCTTCCAAACGTCAGTTTTCTGTCTCCGGC
AAAACGTGTTTAAAGACCCGGTGTTGCTTTATAAACGGCA
GGCGTTCGACGGGATTTATTTCTCGCTGGTTTTCCTGACG
CTCCTGTGCACGTATTTAAAGATCATGTTCACAGCGCATT
CGCATTCAACCGAGAACACATCCGCCAAACGGGCGACCAA
CACCATCCTTCTTCACGGGCTGCAGCTGATCATGTGTTTG
CTCTCCTACATTTCCCCAAGCGTGGAAGGAATACTGAACA
TCATCTTCCCAGGACGCGTTCTGGAGATCCGTTTCGCCAA
CTATCTGATCGTTTACATTCTGCCACGCTTTTTGAGTCCG
ATCATATATGGCGTGCGGGATAAGAAATTCCGCAAGTATC
TGAGGAGGTATTTTGTCTGTGGCGTTTCTACAATGGAAAC
AAGAGTTGAGTGTAAAGATGGAGATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations