Transcript

or137-3-201

ID
ZDB-TSCRIPT-090929-17766
Name
or137-3-201
Previous Names
  • or137-3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037343 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037343|OTTDARG00000027676|ZDB-GENE-070806-24 or137-3|OTTDARP00000029921 or137-3-001 LG_ BX649282.8 Danio rerio protein_coding KNOWN, 933 bp
ATGAATTCTACAATGTTTACGTACACTAATGTAGACAGAT
ATGCGGAGGCTTTCGCAAAAAATTTCACCACAGTTCTTCT
TGGGCTCATAATTACCTGCGTCAATGGATTATTTGTTTTC
ACTTTCTTCAAGAGTTCAATATTCTACAACGATCCAAGAT
ACATATTATATGTTCACATGGTTATCTGTGATATGCTCAT
GGTTATTTTCAGTGTAGGTCTCTCTGTGATGGCTTATGCA
TGGCCAAATGTTCCTGTACCATTTTGTGTAACACTTCTAC
TAATATCCTCAACAACCCATAAGAACACTCCTCTGACTTT
GGCTGGTATGGCCATTGAGCGTTACATTGCCATCTGCAAA
CCACTGCATCACAATCAGATCTGCACAGTGCGCAGGACGT
ACATCCTCATCTCTCTTATATGGAGTGTTGGAGTTTTACC
TTCATTGGCTGACTTGATTCTCCTTTCAATTGTTCGTCCT
TTGGCTTTTTACACAAGTGCTCTCTGTAGTACATCTAATT
TGTATAGCACACCGTACCATGAAGAACAGAGTAAAATTAC
ACATGGGATATATACAACTGTTGTGTGGGTAATTCTTGTG
TACACATATTGTCGAGTGCTGATTGCTGCCAGAAAAGCAA
CCGCTGACAAATCCTCAGCAAAAAAGGCCCAAAATACAAT
ACTGTTACATGGAGTACAGCTCTTGCTCTCTATGATGTCC
AATATTACTCCTGTTATAGACAAGATTTATGCCCAACTTC
TTCCCACATTACGGTCAAAAATCACCTTTTTCAATTATCT
TTTTACAAATTTATTACCACGACTGCTAAGCCCTCTTATT
TATGGTGTTCGAGATAAACATTTTTTGAAATACCTGAAAG
GGCTGTTTTTATGTCGATTATTTCATGTAAAAGTTCAACC
AGCCAAATCATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations