Transcript

or137-9-201

ID
ZDB-TSCRIPT-090929-17759
Name
or137-9-201
Previous Names
  • or137-9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037336 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037336|OTTDARG00000027669|ZDB-GENE-070806-29 or137-9|OTTDARP00000029914 or137-9-001 LG_ BX649282.8 Danio rerio protein_coding KNOWN, 933 bp
ATGAACTCCACTATGCTTCAGGTTAATGCACAAGACAGAT
TCAGGGATGCTTGGGTTAGAAATTTCATTGTTGTTATCTT
TGGAATCACAATTAACTCCATCAATGGCGTGTTTGTGTTT
ACATTCTTTAAGAATTCAGTTTTCTACAATGATCCAAGAT
ATATTCTATATATTCACTTGGTTATCAATGATATGCTCAT
GGTTTTTGTAAGTGTGTCTCTTTCTGTGATGGCTTATGCA
TGGCGAAATGTACCTATCCCGTTTTGTGTTGTACTACTGA
TAATAGCTTCAAAAACTCATAAGAACAGTGTTCTGACTTT
AGCTGGCATGTCTGTTGAGCGTTACATTGCCATCTGCAAA
CCACTGCATCACCATCAGATTTGCACAGTGCGCAGGACAT
ACATCCTCATCTCTCTGATATGGAGTGTTGGAGTTTTACC
TGGATTGGCTGATTTTATTCTCCTTTCAGTTATTGATCCT
TTTTTCTATACTAAAGATACTATCTGTTCAACATCAAGGC
TTTATAACACACCTTACCATGAAGAACTTAGCAAATATAT
GACTGGCATTTATTCATCTGGTGTTTGGTTAATACTCATA
TACACATACTGTCGAGTGTTGATCACAGCCAGAAAGGCCT
CCACAGATAAATCCTCAGCAAAAAAAGCCCAAAGCACCAT
CCTGCTACACGGAGCACAGCTTCTACTGTGTATGCTGTCC
TACATTACTGGCTACCTAGAACTGATGTATGCTCAACTGT
TACCAGCCGATCGGTCAATATTGCTCTTCTGTAATTACCT
TCTGACAAATTTACTACCGCGACTGCTCACCCCACTGATT
TACGGTGTTCGAGATAAAGTGTTTTATAGTCACATGAAAG
GCATTGTTGCATGTAAATTAGTTATTGTAAAGGTTGAATC
AACCAAACAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations