ZFIN ID: ZDB-TSCRIPT-090929-1771
Transcript Name: zgc:174564-202
Previous Name: si:ch211-222k6.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000010535 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000010535|OTTDARG00000009173|ZDB-GENE-050208-649 si:ch211-222k6.1|OTTDARP00000009069 CH211-222K6.1-001 LG_ BX324216.9 Danio rerio protein_coding NOVEL, 771 bp
AAGTGAAGAAGAGTTTGTAAAAAGGACACTGGCAACATGG
ATGGTCCAGAATCCTGCAGAATAAAACATGAAGATGCTGA
AGAATTAATAGACCTGATGGAGGAGAACGGGGAGACTGGA
GAACAGCTTGAAGCAGTAGAGAAACATCAGGACACACATG
GACAAAAATCCACGAGTCTCTCTTTCCAAAGCAGACCTGA
AGTACACTTCACATGCCCTCAGTGTGGAAAGAGTTTCTCA
TGTGAACAAAGTCTCAATCTTCACATGAAGTTTCATCGAG
GAACAAAGCCGTATGAGTGTGATCAATGCGATAAGATATT
CACACTAAAAACAAACCTTAATGAACACATGAAAATTCAC
AATGTAGACATGCTGTACACATGTGATCAGTGCGGGAAGA
AATTTCCTCCATAAAGGATACCTTACAGAGCACATAAAAA
TCCACACTGGAGAGAAGCCGCACACGTGTGATCAGTGCGG
GAAGAGATTCGCATATAAGGGAAACCTCACAGATCACATG
AAAGTCCACACTGGAGAGAGGCCTTATGCATGCGATCAGT
GTGCCAAGAGATTCAAACACAAAGGAAATCTTATTGAACA
TGTGAAGATTCACACAGGAGAGAGGCCGTACTCGTGTGAT
CAGTGCGGGAAGAAATTTAAACTCAAACACATCCTCAGTG
ACCACATGAGAATCCACACCGGAGAGAAACCCTTCACTTG
TGAGAAATGTGGGAGAAGTTACACACGAAAGCGGAATCTT
TCCGATCACAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:174564-202 Contained in:
[BAC] CH211-222K6 (1)

Genome Resources: Vega_Trans:OTTDART00000010535 (1),  Ensembl_Trans:ENSDART00000144811 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK027122 (1) 774 nt
GenBank:BI984149 (1) 587 nt
GenBank:CD604405 (1) 308 nt
CITATIONS (2)