header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17682
Transcript Name: srpk1b-201
Previous Name: srpk1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037256 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037256|OTTDARG00000027627|ZDB-GENE-070112-2292 srpk1b|OTTDARP00000029857 srpk1b-001 LG_none CR318593.16,CT583672.11 Danio rerio protein_coding KNOWN, 2370 bp
ATGCGCCGACCGTTACATGTGAGTGACTGTGAGCACTTTA
GCCGCCGGTGCAGCATGGAAAGGAAAGTACTTGCACTTCA
GGCCAGGAAGAAAAGGACCAAAACCAAGAAACCTGGCAAA
AAGCCTGATCCTCACCCGAGGGGCGCCGCGCAGCAGCCTG
ACGCTCTGCAGGAGCAAGATGAAGAGATCCTGGGCTCCGA
TGATGAAGAACAGGAGGATCCCAATGATTACTGCAAGGGT
GGTTACCACCATGTGAAAATAGGCGACCTGTTCAACGGAC
GGTATCATGTAATCCGCAAGCTGGGTTGGGGCCACTTTTC
CACTGTTTGGCTTGCCTGGGACACACAAGGGAAGCGTTTT
GTGGCCATGAAAGTGGTGAAGAGCGCCGAACACTACACTG
AAACAGCCCTGGATGAGATCAAGCTCCTGAAAGCTGTCAG
GAACACAGACCAGAATGATCCCAGCAGAGAGAAAGTGGTG
CAGTTATTGGATGACTTCAAGATCTCAGGCGTCAACGGAA
CCCATGTGTGTATGGTGTTTGAAGTTCTCGGCCACCATCT
GCTCAAGTGGATTATTAAGTCTAATTATCAGGGCCTGCCT
CTGCCGTGTGTCAAAAGCATCATTCGACAGGTTCTGCAAG
GCCTGGATTACCTGCACACCAAGTGTAAGATCATTCACAC
TGACATAAAGCCAGAGAACATCCTCATGGACGTCAATGAA
GCGTATGTAAAGAGACTGGCAGCGGAGGCCACAGAATGGC
AGAAATCTGGAGCTCCACCGCCTTCTGGGTCCGCAGTGAG
TACAGCTCCAGCCCCAAAACAAGCGACTAAAATGTCCAAG
AACAAGAAGAAAAAGATGAAGAAGAAGCAGAAGCGTCAGG
CGGAGCTCTTGGAGAAGAGGATTCTGGAGATCGAGGGACT
GGAGAAAGGGCTAGATGGAGGAGAAGAGGAAGATGAGGAT
GAAACGGAGACGCCCGACAGCACCCCGTCAGTGCCCAGCA
GTCACACGCTACAGGACATCAGCACTGAGACCACACTGGA
TGGCACCTCAGAAGCTTGGTCTCAGGTCACAGGATCCGTC
AACGGTCACATCCCGAGCCCAGAAGACGAGCAGAGCCTTG
ACGTCCAGCAGCAGATGAAGGACGAGACCCCTGTTAACCC
CTACGACAGCGGCAACGAGACCTCCGAGCCCACCAACCCC
TACCCAGCATGCAACGGCACAGAAGAGACCGAGCCCAGCC
CCGCATGCCTGTCCGCCGCTGACGGTAATGGAGCTTTGAT
TAGTGGCATGGTTGAGTCTCAGGGCTGTAGGGTGCAGGAT
GGAGAAAGCCTGACGGCGGAGCTGAAGGATCCCAGAGCGG
AGATGGAGGCGGAGCCCGGCACGCAGGCGGTCCCAGAAGA
GGAGGAGAGCCTGAAGGACGCTAAAACTGCAGCAGGAAAC
CTGCTAGTCAACCCTCTGGAGCCGCTAAACGCTGAGAAGA
TCCAGGTGAAAATCGCTGACCTGGGCAATGCCTGCTGGGT
GCACAAGCACTTCACAGATGACATTCAGACGCGGCAGTAT
CGCTCTCTGGAGGTGCTGATCGGAACGGGATACGGTACTC
CAGCAGACATCTGGAGCACAGCCTGCATGGCGTTTGAGCT
GGCTACCGGAGATTACCTGTTTGAGCCTCACTCCGGAGAG
GATTATTCCAGAGATGAAGATCACATCGCATTGATCATTG
AGCTGCTGGGGAAGATTCCTCGTAAACTCGTCATGAATGG
CAAATATTCCAAGGAGTTCTTCACCAAGAAAGGTGACCTA
AGGCACATCACCAAACTGAAACCGTGGGGTTTACAGGACG
TCCTGGTGGAAAAGTACGAGTGGCACCGAGAGGAAGCACA
GAATTTCTCCGACTTCCTCCTGCCGATGTTGGATCTCATC
CCAGAGAAAAGAGCCACGGCCGCCGAGTGCCTCCGTCATT
CCTGGATCAACTCCTAGTGGTCAAAATCACATACACCTAC
ACACACACACACACACTCATGCACTTCTCTGAACTCATGA
ACTATCACACTGACAGACCCTTCTGTCTGAGGAGCCGATA
ACAGCAGATCTGATCTCAATCCATTTCTTTTTTTACTATA
ATTTAGGTGTACCGACATTTCCGTGGCTCGTGCTCTTAAA
CATTTATCTAACAATCACTTTTCTATCAATTTCCATCATA
TCACAGGGATGCTTCGAGACACTTCTGGATTGATTTCTCT
TTTAGAAGGCTGGATTTGCTCCAGTTTCACTGACCGTGAC
CGTTTTTTAGTCCATGTCCGCCAGTAACTCGGACTCGGTA
GCTGATTGTAGTGTTTCTTCACCGTATTAATAAACGATTG
TTAATCGCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
srpk1b-201 Contained in:
OTHER srpk1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037256 (1)
  • Ensembl_Trans:ENSDART00000042972 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC129460 (1) 2388bp
    GenBank:CA474320 (1) 904bp
    CITATIONS (2)