Transcript

ugt5g2-201

ID
ZDB-TSCRIPT-090929-17660
Name
ugt5g2-201
Previous Names
  • ugt5g2-001
  • si:dkey-4c2.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037234 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037234|OTTDARG00000027612|ZDB-GENE-081028-66 ugt5g2|OTTDARP00000029839 DKEY-4C2.5-001 LG_ BX005027.13 Danio rerio protein_coding NOVEL, 1605 bp
ATGCAAGGATGCATGTCCCTCGTTTTCCTTTGGACTTCAT
TACTTCTATCTTTACCCTCTGGCTATAATGCTGACAAGAT
CCTGGTTTTCCCTATTGATGGCAGTCACTGGGTGAACATG
GAGGTGCTGGTGAAGAAGCTGCAGTCTCGTGGACACGAGC
TGAGTGTGATTCGCCTGGAGGACAGCTGGTTCATCAAGGG
CAATTCACCTTACTACTCCTCTATTACAGTGACGCTTAAG
AAGAAATTTATAGACCTGGACCTATTTGAGACAGCAGTAA
AAAAGATTCTTGATGCTCGTAGGGATGGCCCAATAATGGG
AGTGCTGGCACAGATGTCTGAATTTATAGGCATCCTAAAG
GTGGGTCATGGTGCAAACATTGCTATGCTCACCTCCATGC
TAGAAAACAAAGCTCTGATGTCACAAATAAAGATGGCCAA
CTATGACTTGATGCTCACTGACCCTGCCATGCCTGGTGGG
GTCATCTTGGCACATTACCTTCACCTTCCAATGGTCTATA
ATGTCCGTTGGATGAGTTTTGGAGAAGGCCACTTCTCCAT
AGCACCTTCTCCCATCTCCTTTGTTCCTGTGCCTGGTTCT
GGTCTGACAGACCGAATGGGCCTGTTAGAGCGATCCCGTA
ACTTTTTACATTATGGGCTGAACCTCATTCAAGAGCGCTG
GATGGTGATTCCAATGTATACCAGCTTGTTGCTCAACCAC
TTCCCTCCAGGCACTGACCTCCTTACCATGCAGCGATCAG
CAGAACTTTGGTTAGTGCGTGCAGATTTTGTATTCGAGTT
TCCACGACCTTCCATGCCAAACCTCGTCTACATTGGTGGC
TTCCAGTGTCGTCCAGCCAAGCCTCTTCCTGCTGATCTGG
AGGAGTTCATGCAGAGCTCAGGAGACCATGGGGTGGTCGT
GATGTCTTTGGGAACTCTGATCGCAGGATTGCCCAAAGAA
GTCATGGAGGCCATCGCCTCAGCGTTTGCTCAGATCCCGC
AGAAGGTGATCTGGAGGTTTATTGGACAGAGACCTTCAAC
GTTGGGCAATAACACCCTACTTATTCAATGGCTTCCTCAG
AATGACTTGCTGGGCCATCCGAAGACTCGTGCTTTTGTGG
CTCATGGTGGCACCAATGGTCTATATGAAGCGATTTATCA
TGGAGTTCCAGTTTTGGGGCTCCCTTTGCTATTTGATCAG
CTAGATAACATTGTACGTCTTCAGGCGAGAGGTGGAGCTC
GGATGTTGGATGCAGCTACTTGTAGCACAAAAGAATTCCT
CGTAGCTTTGACGGATATCTTAGAGAACCCAACTTATCGA
CAAAACATGCAAAAGCTCTCTAATTTACATCGAGACCGGC
CTTTGCACCCTCTTGATAAAGCAGTGTATTGGATTGAGTT
TGTCCTGCGTAATAAAGGTGCACCCCATCTGCGAGCAGAG
GCCTACAACATGTCTGAGTTCTCCTACTACTGTCTGGATG
TGGTCGCGCTGGTTCTCTTCATGCTTCTGGGGACTTTAGG
AGGTGTTTATACAATATGTAAAAGAAGACCAAAAAGACAA
GAAAACAAGACTGGGAGAGATTGGAACAAAAAAGGTCTAA
AGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations