header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17615
Transcript Name: cyp2x10.2-203
Previous Names: cyp2x10.2-002, zgc:136371-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037188 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037188|OTTDARG00000027591|ZDB-GENE-060818-12 cyp2x10.2|OTTDARP00000029809 CH211-122F10.3-002 LG_ BX957362.26 Danio rerio protein_coding KNOWN, 1575 bp
ATCAGTAACCATGTTGACTGCACTGGTTCTGTTGTGTCTT
GGAGCTTTTCTTTTGTACTTACAGCTGAGAATTCGGCGAC
CCAAAAACTTTCCTCCTGGACCCGCACCTGTTCCAATCTT
TGGTAATTTGTTGCAACTGAATCGCATAAGCCCATTAAAA
GACTTTGATAAGTTTGCTCAGCACTATGGATCAATCTATG
GGATATACATTGGTTCACAGCCAGCAGTGGTGTTAACGGG
ACAGAAAATGATCAAGGAGGCACTGATCACACAAGCGGCT
GAGTTTTCTGGCAGATCAAATAATATGATGTTTAGCCATG
TAACAGGGGGCAAAGGGGTCATCATGGCAGATTATGGAGA
AAGTTGGCGTGAACATCGGCGCTTTGCTCTGACCACACTG
AGGAACTTCGGCCTTGGAAAGAAAAGTATGGAGCAGAGGA
TTCTGGAGGAGGTCAAACATATCTGTTTACTACTGGAGGA
ATCTGCTGGAAAGTCAATTGACCCTCAGCATCTGTATCAC
CAAGCTGCCTCAAACATTATAGCCTCAGTCATTTTTGGGT
CACGATTCAATTACAAGGATGCATATTTCCAGACATTGAT
CACAAGTGTGGAAGATCTTACCAAGATTACAATTGGACCA
TGGGCAATGCTCTATGAAATAGCACCAGTGTTGAGGATTT
TCCCACTGCCATTCCAAAAAGCTTTTCAATATTTTGAGCA
AATCACAAAACATGTTCTTAAAGTTGTGGAGGAACACAAG
ACGTCACGTGTTGCTGGGGAGCCCAGAGACTTGATTGATT
GTTACTTGGAGGAGATGGAGAATAAATCAGATCATCGCAC
CTCATTTGATGAGTCGCAGATGGTCACTTTGCTGTTTGAC
CTGTTTATTGCTGGAACTGAAACAACCTCTAACACACTCC
GCACTTTAACTCTGTATTTGATGACTTACACTCATATTCA
AGAGCAATGTCAGCGGGAGATCGATGAAGTCCTTGGTGCT
CGTGATCATGTCACATATGAGGACAGAAACGCCATGCATT
TTGTTCAAGCAGTGATTCATGAGGGTCAGCGTGTTGCTGA
TATTGCTCCTCTTAGTATGTTTCACTCTGCCAAAACCGAC
ACTCAACTCAGGGGCTACAGCATCCCAAAGGGGACAATTA
TCATCCCGTATCTGTCATCTTCTCTCAGAGAGGAAGGTGT
GTGCTACATCAGTTCCATTAAACAGTATTATGAGGACCTC
GTGTTTGTTTAGGAGAAAATCTAGCCCGCATGGAGCTCTT
CCTCATCCTGGTCACTGTACTGCGGAGATTTCGTCTGGTC
TGGCCGAAGGATGCAGGAGAGCCAGACTTCACATATATAT
ATGGTGGGACTCAATCAGTGAAACCTTACCGTGTAATTGT
AGAGCCGCGAATGCATGGAGAGGCTTGTAAATTTGTCGAC
TGAACATATGCTGCCTACTATTTCATGCTATACCAGGGCT
GATTCGAGACATTTGGAGGCCCAATGCAAAATTTATATCA
GAGTTCTGCACGGTCTCCTCTCCACCTTTCACAACAAATA
AAAGCTATTGAATTA

cyp2x10.2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cyp2x10.2-201 (1) 1661
cyp2x10.2-202 (1) 936
cyp2x10.2-203 1575
cyp2x10.2-204 (1) 758
cyp2x10.2-205 (1) 1577
cyp2x10.2-206 (1) 1635
cyp2x10.2-207 (1) 936
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyp2x10.2-203 Contained in:
OTHER cyp2x10.2-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037188 (1)
  • Ensembl_Trans:ENSDART00000145645 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC115101 (1) 1593bp
    CITATIONS (2)