Community Action Needed: Please respond to the NIH RFI
Transcript

psmd4b-201

ID
ZDB-TSCRIPT-090929-17613
Name
psmd4b-201
Previous Names
  • psmd4b-001
  • psmd4l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037186 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037186|OTTDARG00000027590|ZDB-GENE-050417-96 psmd4b|OTTDARP00000029807 psmd4b-001 LG_ CU104697.13 Danio rerio protein_coding KNOWN, 1530 bp
TACGTCACGTAGAGCGACAAAAAATTTCAAGATGGTGCTT
GAAAGTACTATGGTCTGTGTGGACAACAGTGAATATATGC
GCAATGGAGACTTCTTACCTACCAGACTTCAGGCCCAGCA
AGATGCTGTTAACATTATCTGTCATTCGAAAACTCGAAGT
AACCCAGAAAACAACGTGGGACTCATCACTATGGCCAATA
ACTGTGAGGTCCTGACCACACTGACCCCTGACACGGGCAG
GATTCTGTCAAAGCTTCATGCTGTTCAGCCCAGAGGAGTC
ATCAGCTTCTGTACAGGCATCAGAGTGGCACATCTGGCTT
TGAAACACAGACAGGGAAAGAACCATAAGATGAGGATCAT
TGCCTTTGTGGGAAGCCCTGTGGAGGACCAGGAGAAAGAT
TTGGTGAAGATGGCAAAACGTTTGAAGAAGGAAAAAGTCA
GCGTTGACATCATTAACTTTGGAGAAGAGGAGGTCAACAC
AGAGAAACTGACTGTGTTTGTGAACACCCTGAATGGAAAG
GAGGGTGTGGGTTCTCACCTGGTCACGGTTCCTCCTGGCC
CAAGCCTGGCAGATGCACTCTTATCATCTCCTATCATGGC
TGGAGAGGGTGGCACTATTATGGGCCTTGGTGCCAGTGAT
TTTGAGTTTGGAGTGGACCCAAGCGCAGACCCTGAGCTTG
CTCTGGCTTTGCGTGTGTCGATGGAGGAGCAGAGACAAAG
GCAGGAGGAAGAGGCTCGGAGGGCAGCAGTGGCTTCAGCT
GCAGATGCTGGAGTCTCATCTCCTACTGCAGATGAGTCTG
AAAATGCCCTGTTGAAGATGTCGACAGCTCCAGCTCTGCC
TGATTTCAGCCGCATGACAGAGGATGAACAGATCGCATAC
GCCCTTCAGATGTCCATGCAAGGAGGAGAATTTGGTGGTT
CAGAGGCCATGGATGTGGATACAGCAGCTGCAGCAGCAGA
GAGTGAAGCTCCTAAGGAGGATGAGGAGGATTACGATGTG
ATGCAGGATCCAGAGTTTTTGCAGAGTGTGCTTGAGAACC
TACCAGGTGTCGACCCCAATAACGAAGCCATTCGTAATGC
CATGGGCTCACTGGCGTCTCAGAACAGAACTAAACCACCT
GAGGGCAAGAAAGAGGATGAGAAGAAATAGAGGAAGATGT
TAGAGAGAGGAACAACAGAACAGACTAATAACAAATACTT
CTGAAAGAAAACAAATATCCATAAACACTTACCTGTAACG
ATGAATAAGCATTTTCATTTGTCTGTCTTAAGTTTCATCA
AGTAGCATCTGATCTGTAACATATTTGATGGAGCAGAAAA
TAACCACGTGACGCTACTTAAAATAGTAGTGCTCTCTTCA
GTGTTTCTTTGTTAGATGGGTTATTTTAAGCGACCCAGCT
ATAATATCTCTTTAATTTCTCTTGTGTTTTTGGTTAACAT
CTTGTAAAAGTTTCTTTGTTCATTTTGTATCACTGTTTTC
AGTTCCTTTTGTAATAAAGGGCTTTGCTATGGTTGAGGGT
ATCTAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations