Community Action Needed: Please respond to the NIH RFI
Transcript

znf990-201

ID
ZDB-TSCRIPT-090929-1754
Name
znf990-201
Previous Names
  • znf990-001
  • si:dkey-253d23.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000010518 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000010518|OTTDARG00000009159|ZDB-GENE-051113-232 znf990|OTTDARP00000009055 DKEY-253D23.6-001 LG_ BX539307.6 Danio rerio protein_coding NOVEL, 880 bp
GGGAACTCTTCGGGGAAAAATAAAAAAAGCAAATCACAGG
GTAACGTTGGGTCTTCAAGGCTGAGTTCTTTAACTGTGAA
GCTTCACCAGTAAATGCTGAAACATTCCCATCAACCAAGA
AGTGAAGCAAAGTTTGTGAGAGAACAGTGAGAACATGAGT
GATTCAGGAGTCTGCACAATAAAACAGGAAGATGCTGAAG
AACAAATAGACTTGTTAAATGAGAACAAGGAGATTGAAGA
TCTGATTAAAAGGGGAGAGAAACATCACATCAAAACAGAA
GAAAACCTTTACAGTATCTCAACGATAAGAAAAGACAATC
CATGTTTCACATGCCTTCAGTGTAAAAACACTTTCTCATG
CGAGGAAAGTCTAAATCTTCACATGAAGATTCATAGAGAG
GTGAAGCCACACACCTCTGATCAATGTGATGAGATTTTCA
CCGTAAAAGTTACAAATAACGTAAATGTCCACGCTGAGGA
AACGGTGTACAATTGTGATCAGTGTGACAGGACTTTCACA
GATAAGAGAAATTTAGCCGCACACATGAAATTTCACAGCG
GAGAGAAGCCCTTCATGTGTGATCTATGTGGGAGGAGTTT
TCTTTATGCAAATACATTAAAAAAACACCGAAATTTACAC
AGCGCTGTGAAGAATCACGTCTGCTCCAAGTGTGGCAAGA
GCTTTTTCACATTCAGTCAATTAAAAATCCACCACACAGC
TCACGCTACAGAAAAACCTTTCAAATGTTCACACTGTGGC
AAGGCGTTCAAATCATTACAGTGTCAACGAATACATGAGA
TGATCCACAGCGGAGAAAAGCCACACAAGTGCGATCAGTG
CGAGAAGACTTTCAGACAGAGGAAAAGTTTAAACATCCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations