ZFIN ID: ZDB-TSCRIPT-090929-17528
Transcript Name: tssc4-204
Previous Name: tssc4-008

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037097 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037097|OTTDARG00000027546|ZDB-GENE-060825-263 tssc4|OTTDARP00000029742 DKEY-46P12.1-008 LG_ BX537356.4 Danio rerio protein_coding KNOWN, 954 bp
GCGTGCGCACTTGCTGCAGCTAAAGGTACGCTACTGGTAA
TGTGGAGAATCAGATACGAGTCAAATTTATAGGAAGAAGA
GGACAGAATCGAGACTAAACGCTATGGCCACAACTTTCAC
CAATACTCCTTACTCAGAACTGACCAGCTCGCATTACCTG
TTCCAACAGGTGTCTCAAGAACATTTTGATCCTTCATTCA
GTATCTCAGTATAAATATCCAGCACAATGAGTGACCGAAA
GCGCAAAGGCAACGACGCCCCCAACAGTCTGTCTAACAGA
GACACTGTTGAACTTCCTGATGATCTCTCCTTGAGCGACT
CTGACTCTGATGAGCCCTTAGAGAGTTTCGGTAGAAAAAT
TGAGGACTTATCCTCGTCCTCAGAGGAGGAAGGCGAGACT
CGGCAGCCGGTCCAGTCAGTTCTTCAAGAGAATCCATCCT
TCAGACTGACAGGCGGGAGCTCTAGTTTCTGTGATCGCAG
CAGGGACATCTTTGCACAGCTGGATAGTGCTGCAAAGCTC
ACCTCTAAAGATCTAGGTGAAGATAATATCCTTGATGGCA
CATTTGCCCGTCCTGCACCACCTTCACCCCCACATGCAGT
GCAAAACAAGTGTGGTGTCGGCCAAGAGCTTACCAAGAAA
CAACCTCCAGGTAAAAAACTCCCAGACTACCTCGCACACC
CTGAGCGTTGGACACACTACAGTCTTGAAGACATCGATGA
AACCAGTGATAAAAAGAATAGTCAGGTTGCTCATGAGTAC
ATACGAGAGCTTCAGGATAGCAAGAGGTCCCAGAAAGCTG
CGCTTGAGACTTTTACTCCAGCTTTCAACCAGGATCATGG
CAGCAGCAATGAGAATAAGATTGTGTTCGCTAAACCCAAG
AGCAAAGATCAAAGTGGGAGCAAAGCTGATCACGCTAAGA
AGGAAGAAGTTGGACTTCAACACTTGGATGACAG

tssc4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA tssc4-201 (1)    Ensembl 1382
tssc4-202 (1)    Ensembl 801
tssc4-203 (1)    Ensembl 940
tssc4-204 954
tssc4-205 (1)    Ensembl 892
tssc4-206 (1)    Ensembl 884
tssc4-207 (1)    Ensembl 916
tssc4-208 (1)    Ensembl 798
tssc4-209 (1)    Ensembl 831
tssc4-210 (1)    Ensembl 780
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tssc4-204 Contained in:
[BAC] DKEY-46P12 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000037097 (1),  Ensembl_Trans:ENSDART00000135237 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE704679 (1) 967 nt
GenBank:EE697415 (1) 938 nt
GenBank:EH537558 (1) 930 nt
CITATIONS (2)