Transcript

cdh28-201

ID
ZDB-TSCRIPT-090929-17348
Name
cdh28-201
Previous Names
  • cdh28-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036903 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036903|OTTDARG00000027439|ZDB-GENE-081104-9 si:dkey-173l11.3|OTTDARP00000029585 DKEY-173L11.3-001 LG_ BX322631.8 Danio rerio protein_coding NOVEL, 2488 bp
CAACCAGAAAGGAAGTGATTTCTCCAAGACCTTTCAAAAC
ATTTTGTTTCAAACGGAGACAATTATGACTGTCCGATTGG
GAACCCTCTTTGTGATTTTTAAGATATTGTCTTGTGGATT
TGCAGAGGAGTCTCCATGTACACCTGGTTTTGAGTCAAAG
CTGCTGGTTGTTAAAGTCCACAAAGATCACCTTCACAAAG
GAGAGAGACTCGGGAGAGTCGTATTTAGCACATGTGATGG
AAGAACAGGAATAGATTTTCAGTCCACTGATCAGGAGATT
GATCTGAACATGGATGGGACTCTGATGATGAGGAGGTCAG
TGACTCTTCATGAAGGCCTCAAGGAGTTTTCAGTGTCTGC
ATGGGACTTCAGTGGCAAGAAGCACACAGTCTTTGTCAGA
GTTGAGCGTGTCGATTATCATAAGGATCATGACGTGAATA
CATTAATGAATACTTCCTCTGTACAGACGAAATCTCTCTC
TGATGATCTAATTTTGATATTCCCAAAGTCTTCATTGGGT
TTAAATAGAGCAAAGAGATGCTGGATTTTACCTCCATTAA
CATTACATGAGAATGGCAAAGGTCCTTTCCCAATGAGGCT
GTTCCAGATAAAGTCAGATTCTGCTTCTGAAACTCCAATG
GCATACAAGATCACTGGTGAAGGAGCAGATCAGGACCCTA
AGGGAATTTTTCAAATAGACAGACTATCAGGATGGGTCAG
TGTAACTCAGCAACTTGACAGAGAAAAAAAAGCTTCATAC
AAACTTGTAGCTCATGCCACTGGAGTGGATGCGAATATAG
TGGAAAAGCCATTCGAATTTATTGTAACTGTGATGGATCA
AAATGATAATAAGCCAGTGTTTACTCAAAACCCTTTCAAT
GCAAATGTTCCTGAAGCTTTGGAAAAGGGTGAAGTGTTTA
TGACGGTCACAGCCACTGATGCAGATGATAAAGAAAATAC
TGACAATGCTGATATCAGTTATGCCATTATCAGCCAAGAT
CCACCATCTCCAAAACCAAACATGTTTGCTATCAATCCTG
TAAGTGGAGGGATTTCTATGCTGGAAACAGGCCTGGACAG
AGAGCAATGGTCCAGTTATACTTTGGTTATTACGGCTACT
GATATGAACGGAGAGGGTGGGTCAACCACTGGCACAGCAG
TTATTACTGTTACAGACAGCAATAATAATGCACCTCTGTT
TGAGCAAACCTTGTACACTGTATCTGTCCCAGAGAATCAA
GTTGGGGCTGAAGTGGCCAAACTTCCAGTTACTGATGGAG
ATGAACCTGAATCAACAGCTTGGTCAACCAAGTATCGAGT
CATTGGTGGTGACAAGGGTGGGTTTTTCAATGTCAGCACT
GGACCCAGCCGTCTTGAGGGCGTCATCACCACTGTAAAGC
CCCTGAACTATGAGAAGAACAAGCAGTACATTCTGTCTGT
GATCGTTGTGAACGATGATAAATTTGTTGGTCCTTTGCCT
ACTTCAACTGCCACAGTCACTGTGAATGTAGAAGATGAGA
ACGAGCCGCCTGAGTTTAATCCAAAGGAGAAGTTTATTTC
CAAACCTGAAGATTTACCTGTTGGTAGTGATTTGGTGAAT
TACACAGCCACTGATCCTGACACTGAAAAAAAGCAAAAGA
TAATTTATAGAATTGGCAATGATCCTTCTGGCTGGCTCAG
TGTAACAGATGCTGGACAGATTCAAGTCAAGAAACCTATG
GATCGAGAAAATCCCAGTGTCAAGGATGGCAAATACAAAG
CTGTTATTTTGGCTTTGGATGATGCTGATACTCCAACAAC
TGGCACAGGAACACTGGTAATTGAGCTGCAGGATGTAAAT
GACAATGCTCCGGTTATTCACGAAAGGACCATAGAATTGT
GCAATCAAGATTCAGGCCCAGTGCTTCTCTCTATAACGGA
CAATGATGGACCTCCTTTTGCTGGTCCCTTCACAGTTGAG
CCCCAAGGTGATACTAGTAAAAACTGGTCTGTGTTTTTCA
ATGAAACCGGTCATTATCTAAGTCTCAAGCCTCAATCTCA
GTTGGAGCAGCGTGAATACAATTTAGTCCTGAGAGTTACT
GATCGGGAGGGTCAATCTCAGGAGAGTGCCATTCAAGCAA
GTGTGTGTGACTGCAAAGGAGAGGCATTCCAATGTACTAA
CAAACAAGTAGCAGGGGTTCCACTGTTAGGTTTTCTTGGC
ATTCTGGGAGGGATCTTGCTCTTTGTTCTGCTCATTTTAA
AGTTGTACATCCTTCCTCGGTACTTGCTCTTCTTCTCCTC
ATGTTCCTGCAGAGGAAAAACAACACCCCTCCTTTCAGTA
GATGATGTAAGAGTCAACATCTGCTATGATGATGAGGAAT
GCGGTGGAGAAGGTGATCAGAATTGATCAGAAATGAATGT
CATTGTTTATTACTTTGCTCTTAAGAGGCTCTTAATTTTA
ACTGCTGATAAGTGTGACGTCACGCAAAGCGGCTTCCGGG
TCCAAGCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations