ZFIN ID: ZDB-TSCRIPT-090929-17315
Transcript Name: plekhm1-201
Previous Names: plekhm1-002, ottdart00000036870, zgc:158281-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036870 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036870|OTTDARG00000027419|ZDB-GENE-030131-2752 plekhm1|OTTDARP00000029557 CH211-93E11.3-002 LG_ BX323464.18 Danio rerio protein_coding KNOWN, 6274 bp
AGATATCACACGACTCGAGCTCACGTCGCTTCAGTACGAG
GAAAGAAAACACAAGAGGCACGATGAGCGCGTAGGAGTTC
AGAGGAACCCACGACGCATCGACGCAGAACAGGCATGTGT
GTGAAGTGGAAATAATCACAGCTAGAGGAGCCATGCTGGC
CACCCAAACACCTGAGAGCGGCCCAGACGCTAAAGATGTT
AAACAGTGGATCAAGGGCAAGATCGCACATACATTAAAAG
CCCTGCAGAAGCGCTACATCACCACAGACACGGCGGTCAC
CAGTGAGGATCTAGAAGCAAACCTGCTGTGCTGTGCTTTG
GAGGCGGTTTTCATCCATGGAATCAAGAGTAAGTTCATCC
GATCTGATGGAGGTCAAGTGCGCAAAGGAGGATCTCGAGG
AGCGCTGCCTCAGCCAGTCTTCTGGGCTCTGTTGAAGACT
GTCACCCACAGGGATGTAGTTCAAGAACTGGAACGTCTAA
GCTTCATTAACTCTGATGTGGGCCGCTGCAGAGCATGGGT
CCGGCTGGCGCTGAACGACGGGCTTCTGGAGTGTTACCTG
ACCTCGCTGCTTCGTGAAAACTCCAAAATGAGCACCTACT
ATCAGCCCGGGGCTCTTCTGCTGGACCCGGAGGACCGAGA
GGTGCTTCTCACCCTCCTGCAGGGCTTGGCTTCACTGACC
TTCCAGCTTTCCTACAAATCTGCTGTGCTCAATGAATGGA
CCAACACGCCGCTGGTCCTTGCAGGTCTTTGCCCTCCAAC
TCCTGCCGACGAGCAGCATCTTGGTCCCAAACGCAAGGAG
TCCTGGGATACGGTGTCCCAGTCATCCGGCGGCTCTGGAG
GCTCGGATTGGACTCCCGAATCGCTCCAGAGGGAGACGAG
GAGAGATCAGATTGATGGCTGTGATCCCAGCACTCCGCTG
ACCTCCTCAAACCTAAGTCTGGACACCGTGTCGGGGTCTT
CGCATCTGTCCTCCAGCCTGAGCTCTGACAGTCTGCTGCA
AGGCCAGGAGCTCAGGAGCCCAGAGAAGGAGCGCTGGAGC
TGCGACTCCGAGATCAACCACAATGAACAGCAGAAGATCA
CGGCTACAGAAGAGAGCCTGATGAAGGAGGACATTGATGT
GTTCATACCAGCTCCAGACAATCTGACTGACACGCATTCT
GTCAACGAGCACACGCACATACCTGACGCCTCACTGACAT
CAGCACAGGACACGCATCACTCGCACATCACAGAGCAATC
TGTAGAGAACATATCAGTGGAGACGAAAGAAGAAACAATA
GAAGAATCTGAGATTATAGTTAAAAGCACAAGACTTAAAG
CTAAAAATACTGTGAGTGAGACTGCAGAGAAGGAGAAGAA
GAGGGAGAGCAGAGACTCATCTGTTGATCCTCCTTCAGTT
TCTGCTTTAACAGAGACTGAGGAGACGCCTGACCCTAAAG
ACACTGTTCTTTCAGAAATTTCTGCTGCTCCTAGTCCAGT
GGAAACACCTCAACATGCTGCATGCAGACGCACCACAATG
AGCGTCAGCAGGAAAATATCCACAGACTCGCTCTATTCCT
CCTGTAAATCTACATCTTGGATCTCAGAGGAGGATTTCCA
CAAACCCGAAGACTTGAGTATTTCTGAAGCTTATGCCATC
ATTGACGTCACTCCGATGAACGGGCAGGTGTCTCCTGTGT
GTGAAGCAGACGAGCTTCAGCCTCCTCCCAGTGTTGTGCA
CCGGAGACACAACGGTCTTCCTAACCCATTCAGAGGTTTG
CTAAAGCTGGGTCAGCTGGAGCGACGCAGCGCGGTGGGTA
TGTGGTGGGATTATTACTGCGAGCTCTCGCCATTTGAGCT
GCGCCTTTACGTCAATGCAGAGGAGCGCGTCTGCAACGAA
AACCTGTCCCTGCTGCGCTGCGAGGACATCCACCTGTACT
CCAGCACCGAGGGCCGATTTCGGCTCACCTTCCCTAACAA
AAGAATCTACCTGCGTGCGCCATCTAAAGGAGAAGCGGAG
GACTGGGTGGACCGAATCACAGAGGCTGTCAACAAACTAC
GGCCCATTATGAGAGATGAACAGTGGGAGGTGCTGCACAC
GTCCAGCGATCAAGAAGTCACATCTCCAGCTCCATCAACA
CCTGAGCACACCATCTCTGAGCTTCCAGATCCTCCACAGT
TAGATTGGACTCGGCATAAAGACCCAGAACCAGACGCCAT
AAAGGAGGCGGTGGTCTATCAGAGCTTGGAGGAGAAGGGC
TGGCGGTGTCTGGTGCTCTCACTCTCTCTCGAGATCCTCA
GAGGTTTCCAGGTCCGAGAAGACTCAAAGACACCACTTTT
CTCACTCCCCATTGGGAGCATCCGGGATGTGGTTCCTGAT
GTTTCTCTGGGCAGTCCTGCGTTTTTTAAGGTTTTGACAG
TGCGGGACACGCTGACGCTGAGGGCGGAGAGCGGTGAGGA
GGCACGAGGGTGGAGGAGTCTGATCAGAGGAGCGCTGGAC
TCCTATCTGGAGACGGAGGATGATGGAGCGGGAGCCTCAG
CTGCTGACGGTGCACAAGGAGGAGTCGTCCACAAGCTTGT
CCAACACAGACTGAAGGGAGACGGAGAGCTGCTGTTACAC
CTGTCTGTTGTGCCCATCGAGAGAGGACTGGACGCACAGA
ATTACAGATGTGCAGGTTGCTCTCGTCAGATCGGTGTGTC
TCTGGGCAGAGGCAGACTGTGTGAGTTCTCCGGTCAGCAG
TTCTGTGATTCCTGCCATCAAGGAGACATGAGCATCATCC
CCTCCCGCATGCTGCACAACTGGGACCTGAAAACTCGCGA
GGTCTCAAGACAAGCCTTTAAGCTGCTGACTCAAATTGAG
CACGAGCCGCTCCTGAACCTTGCTGTTCTGAATCCTGAGC
TGTTTGAACATGCTGACATCATGGCTAAAGTGCAGAACCT
CCGACAGAGACTTCGCTTTCTAGGAGATTACGTTCTCCTC
TGCCGCAGTGGCTTTAGCAAACAGATCCAGCCCAGACTTC
AGCAGAGGACATACTTGTTGGATAACAGTGACGTCTACAG
TGTGTTAGACTTGCAGCAGATAGCAGACGGCCACTACGAG
TCTTACCTGCAGTCTCTAATTCAGTTTGGCTCCAAGCATG
TGCACAACTGTGACCTTTGCACTCAGAGAGGCTTTATATG
TCAGATCTGCAATGCCCCCGACATCATCTTCCCTTTCCAG
TTTGACGTAACTTCCAGGTGTAACGTCTGCAAGACCGTCT
TTCATTCCTCCTGTAGGGCTCAGTGTCCGGTGTGTCCACG
CTGCATCCGGAAACAAAAATACCTGGAGAGAGACTTGGAG
GAATCTTAGCTGTAAAATAAAAACATGAACGATTGCTACA
GAGCTTAAAATACAGGGTTAGTATCAGATGTTATACTTCA
TATAAAGGGTTCAGTTCACCCAAAAATGTAAATGTGTTCA
TCGCTTACTCAGATTACGGTTACAGTCGCGATACTGGAAT
TCGGTACCAAACTGAAATTTTAAAAACGTCCATTTCCCAC
TAACATTTCAGCGGAGAAAGTTCTAAAACACTGCTGATTT
GCCATTGTGTTAACATGCTCAACAGAAATGACTGTGATTG
GCCGTGAAGGTCATCAGTTCACCGAACTCACTGCTGTTTA
CAGCATGTAAACACAGATACAGGGACAGTGGAGTGTTTCA
AAGTCACGTCGATCAGCTGTATTGTCTGTAAGCTGACATT
TGAGCGATCCACTGATGAATCTGATGACTTTAAAACGCTC
CAGTGTCCCTGTATCTGTAGTAAACAGCGGTGAGTTCGGT
GAACTGATGACCTTCACGGCCAATCACAGTCATTTCTGTT
GAGCACATGAACACAATGGCAAATCAGTGCTGTTTAAAAA
TGCACTCAACAGCGCTCAAATGTTAGCGGGAAACGGATGT
TTTAAAAATCTCAGTATCGATTGTTTCCGAATTCCAGTAT
GGTGACAACCCTAAATCAGACTCAAGTGGTTCTACACTTT
TGTTTAGACACAAAACAAGATATTCTGAAGTATCTGCCAT
TGACTCCCATTGTAGTTTTTGTTCAAACTGTGGATGTCAA
TGACTACGCTCTTCAGAATATCTAGTTTTGTGCTCAACAG
AAGAAAGAAATTGAAGTTTAGAAGCACTCGAGTGTACATT
TTCATTTTTGTGTGAACTGCCCCTTTAAGTTATCCGACAG
TTCTCAGTATCTGAACAACTGGAAGTGTTTGTGGAAAGTC
CACCTTAAGTGCACTTATTGACAGATTCACATGTTTATTC
CTCAAATGATGACCAACGAACACCTCTTCAACTGTTATCA
AAGCTATCCTTTCTGCTTTTCAGCTTTATGGACTTTATAA
CCACTTTATAACACTTAAGGGTTCATTAATGCAGTGCTAT
AACTTAAAGGGATAGTTCACCCAAAAATACTTACACACAC
TCAAGTGGTTCCAAATCTTACTGAGTTTTTTCTTCGGTTG
AACACAAAAGAAGATATTTGGAAGAAAGCTGGAAACCGGT
AACCATTGACTTTCATAGTAGGCAAAACTAATTCTAAGGA
TGTCAATGGTTACAGGTTTTTAGCTTTCTTCAAAACATCT
GCTTTTGTGAAGCAGCACAGAAGAAGACAGGTTTAGAACT
GCAGAAAATGCTTTTGTTACTTGGATATTTTGTCTTGTTT
GTTTGTTTGTTCTAGTCCAAATATCTATAAATTCCTAAAT
CAAGAAGATTTTTCTAGACAAGCAAAACATGTTGTCTTCA
GAAATAATATGCCAATATTAAGTGAGTTTTTTCTTAAAAC
AAGTAAAATAATCTGCCAATGGGGTAAGCAAAATAATCTT
ACGTCAAAAGAAAAAACAATATTAATTTGCTTATCCCATT
GGCAGATTATTTTACTTGTTTTAAGGAAAAACTCCCCTAA
TATTGGCATATTATTTCTCAAAACAAGACGATATGTTTTG
CTTGTCTAGGAAATGCTTCTTGATATAAGAAATTTTAGAT
ATTTAGACTAGAAACAAGACAAAAAATCTTAGCAAGAAAA
GCATTGCAGTATTGGATGATGACAGAATTTTCATAACAAG
GCTGTCAATGACCACGTTCTTCAGAATATTCTGCTTTGTG
TTCAACAGCAGACAGAAATTGAAGTTTAGAAGCACTTGAG
TGCGAGTAAACGATAAGGACATTTTCATTTTTGTGTGAAC
TGCCCCTTTAAGAATTGTGGGTGAACTATCCCTCTAAAAG
GATCATACGTATAATATTTGCACGCAAGTAGCAATTTATG
AGTCTTATGTGCAGTTTCTGATTGTGTTATAAAGCAACTT
TAGAAACATTTATTAACACTTGAAGGTGTTATCAGTTCTC
CGGGCTTCACATGTTATTCTAAGAGTTATAAATCATAAGT
GTTTTCTTGTTCTCTGTTTTTATTTTGAGCATGTCACGGC
CAAGGGACTCATATTTATGAAACGGATGGCAAACAGATGC
CACGGATCTTATAACTTGTTTTTTTATGAATGTCTGCAGA
TTTATATGACGTTTACAAATCACTGTATGCATTAATAAGC
ATATTCTTCTGGATGCAGGAATTGTTTAATAGGAGTGTGG
TTAATGAAGTGACAAACATGCACAAGCTCCTTCAACAGGT
CATTTTTCTATTCTACTGTGCCTTTGTTTCAGTTTCCCTG
TAGCATTCATTGTCACTGTAATGGGTTGTGCCAAAAATGT
AACTATTGTAAGCAAATATAAGTTATTAATGTTTTGCATC
CACGTCGGTTATGTGCAAAGAAACCTTCTGACTAAAGGAT
AAACTCTGTTTGATTCCTGTATTAACCAGTGTGTATTTGT
GTTTTGTGTTCGCTGATGAAGGCTGATTCTTTAGCACTTG
TTTTATATCGGAAACTGAATTGGGAGAGATTCATTTTTCT
TCTTTCTTGCTTTTTTTTTTTTGTACTTTTTTAAAAATGC
GATGTTTTATGACAAGCTAAATACATCCCCTATTGATGAT
AAATTGCTTTTATTGTCTCTTTTATCTCATGTTTTGTTAC
TACAAGCAGTGCCACACACACATAAGCATCATCTTTTTAT
ACTCATGAAGGCCCTGTCCACATGAACACGGGTATTTTAA
ACCCACGGTCTCGCTGTTTGTCCACACAAAATGGAGTTTT
GGGTGACTGAAACCGAAACCTTCTGCAAACTCTGGGCAGG
GTGAAAATTTTCCAAACTACAGTATTGTGTGGTTAAAGAT
CCCATGAAATGAAAATAAAAGTTGTGTAGATGTT

plekhm1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA plekhm1-201 6274
plekhm1-202 (1) 5364
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
plekhm1-201 Contained in:
OTHER plekhm1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036870 (1)
  • Ensembl_Trans:ENSDART00000159986 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BQ617272 (1) 724bp
    GenBank:AL927164 (1) 529bp
    CITATIONS (2)